Transcript: Mouse NM_010469.2

Mus musculus homeobox D4 (Hoxd4), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Hoxd4 (15436)
Length:
2560
CDS:
1235..1987

Additional Resources:

NCBI RefSeq record:
NM_010469.2
NBCI Gene record:
Hoxd4 (15436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353626 ACGGACCTGACGACCTTATAG pLKO_005 1967 CDS 100% 13.200 18.480 N HOXD4 n/a
2 TRCN0000436563 TAAACCCTTGGCGAGTCATTA pLKO_005 2235 3UTR 100% 13.200 18.480 N Hoxd4 n/a
3 TRCN0000070455 CATACGGACCTGACGACCTTA pLKO.1 1964 CDS 100% 4.950 6.930 N Hoxd4 n/a
4 TRCN0000329722 TCGGATTGAAATCGCTCACAC pLKO_005 1777 CDS 100% 4.050 5.670 N HOXD4 n/a
5 TRCN0000070453 CGCTGTGGTCTACCCTTGGAT pLKO.1 1618 CDS 100% 1.000 1.400 N Hoxd4 n/a
6 TRCN0000019936 GTCGGATTGAAATCGCTCACA pLKO.1 1776 CDS 100% 2.640 2.112 N HOXD4 n/a
7 TRCN0000329724 ATGAAGAAGGTGCACGTGAAT pLKO_005 1637 CDS 100% 4.950 3.465 N HOXD4 n/a
8 TRCN0000070457 GCAGGTCTTCTTCCTCATCTT pLKO.1 1887 CDS 100% 4.950 3.465 N Hoxd4 n/a
9 TRCN0000419853 CATTTGCAGCCAATGGCCAAG pLKO_005 1937 CDS 100% 2.250 1.575 N Hoxd4 n/a
10 TRCN0000070456 TGCGAGGAATATTTGCAGGGT pLKO.1 1292 CDS 100% 0.660 0.462 N Hoxd4 n/a
11 TRCN0000070454 AGCAAGTCCTAGAACTGGAAA pLKO.1 1719 CDS 100% 4.950 2.970 N Hoxd4 n/a
12 TRCN0000428137 GATCAAGATCTGGTTCCAGAA pLKO_005 1819 CDS 100% 4.050 2.025 Y Hoxa3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00779 pDONR223 100% 88.1% 91.7% None (many diffs) n/a
2 ccsbBroad304_00779 pLX_304 0% 88.1% 91.7% V5 (many diffs) n/a
3 TRCN0000491714 CGGTACTGCTATATAAGCTATTTT pLX_317 45.7% 88.1% 91.7% V5 (many diffs) n/a
Download CSV