Construct: ORF TRCN0000491775
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018423.2_s317c1
- Derived from:
- ccsbBroadEn_12566
- DNA Barcode:
- ATTCCACATCAAACTATGGTGGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FYCO1 (79443)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491775
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79443 | FYCO1 | FYVE and coiled-coil domain... | XR_001740265.1 | 17.4% | (many diffs) | |
2 | human | 79443 | FYCO1 | FYVE and coiled-coil domain... | NM_024513.4 | 17% | 16.8% | (many diffs) |
3 | human | 79443 | FYCO1 | FYVE and coiled-coil domain... | XM_006713333.3 | 17% | 16.8% | (many diffs) |
4 | human | 79443 | FYCO1 | FYVE and coiled-coil domain... | XM_006713334.3 | 17% | 16.8% | (many diffs) |
5 | human | 79443 | FYCO1 | FYVE and coiled-coil domain... | XM_011534111.3 | 17% | 16.8% | (many diffs) |
6 | human | 79443 | FYCO1 | FYVE and coiled-coil domain... | XR_245157.1 | 9.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 831
- ORF length:
- 765
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa caccaaagtg accagtgact ggtactatgc aagaagcccc tttctgcagc 121 caaagctgag ctcggacatt gtgggccaac tctatgagct gactgaggtt cagtttgacc 181 tggcgtcgag gggctttgac ttggatgctg cctggccaac atttgccagg aggacgctga 241 ccactggctc ttctgcttac ctgtggaaac cccctagccg cagctccagc atgagcagct 301 tggtgagcag ctacctgcag actcaagaga tggtgtccaa ctttgacctg aacagccccc 361 taaacaacga ggcattggag ggctttgatg agatgcgact agagctggac cagttggagg 421 tgcggGAGAA GCAGCTACAG GAGCGCATGC AGCAGCTGGA CAGAGAGAAC CAGGAGCTGA 481 GGGCAGCTGT CAGCCAGCAA GGGGAGCAAC TGCAGACAGA GAGGGAGAGG GGGCGCACTG 541 CAGCGGAGGA CAACGTTCGC CTCACTTGCT TGGTAGCTGA GCTCCAGAAG CAGTGGGAGG 601 TCACCCAGGC CACCCAGAAC ACTGTGAAGG AGCTGCAGAC ATGCCTGCAG GCCCTGGAGC 661 TAGGAGCAGC AGAGAAGGAG GAGGACTACC ACACAGCCCT GCGGCGGCTG GAGTCCATGC 721 TGCAGCCCTT GGCACAGGAG CTTGAGGCCA CACGGGACTC ACTGGACAAG AAAAACCAGC 781 ATTTAGCCAG CTTCCCAGGC TGGCTAGCCA TGGCCCTGCA TGTTGGAGAC TGCCCAACTT 841 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 901 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 961 CTTGTGGAAA GGACGAATTC CACATCAAAC TATGGTGGTC ACGCGTTAAG TCgacaatca 1021 acctctggat tacaaaattt gtgaaagatt