Construct: ORF TRCN0000491780
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021712.2_s317c1
- DNA Barcode:
- GTTTAATTCACAACCAGATCCGCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- FLT4 (2324)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491780
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | XM_011534484.2 | 39.7% | 39.7% | (many diffs) |
| 2 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | NM_002020.5 | 37% | 37.1% | 1_2448del;2634G>T;3198C>T |
| 3 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | NM_001354989.2 | 36.8% | 36.9% | (many diffs) |
| 4 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | XM_017009268.1 | 35.9% | 35.9% | (many diffs) |
| 5 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | NM_182925.5 | 35.2% | 35.2% | (many diffs) |
| 6 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | XM_017009266.1 | 35% | 35% | 1_2679del;2865G>T;3429C>T |
| 7 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | XM_017009267.2 | 35% | 35% | 1_2679del;2865G>T;3429C>T |
| 8 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | XM_011534478.3 | 33.4% | 33.4% | (many diffs) |
| 9 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | XM_017009263.1 | 33.3% | 33% | (many diffs) |
| 10 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | XM_017009264.2 | 33.3% | 33% | (many diffs) |
| 11 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | XM_017009265.1 | 33.3% | 33% | (many diffs) |
| 12 | human | 2324 | FLT4 | fms related tyrosine kinase 4 | XR_001742050.2 | 23% | (many diffs) | |
| 13 | mouse | 14257 | Flt4 | FMS-like tyrosine kinase 4 | NM_008029.3 | 30.1% | 31.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 81
- ORF end:
- 1527
- ORF length:
- 1446
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggctacct gtccatcatc atggaccccg gggaggtgcc tctggaggag caatgcgaat 121 acctgtccta cgatgccagc cagtgggaat tcccccgaga gcggctgcac ctggggagag 181 tgctcggcta cggcgccttc gggaaggtgg tggaagcctc cgctttcggc atccacaagg 241 gcagcagctg tgacaccgtg gccgttaaaa tgctgaaaga gggcgccacg gccagcgagc 301 accgcgcgct gatgtcggag ctcaagatcc tcattcacat cggcaaccac ctcaacgtgg 361 tcaacctcct cggggcgtgc accaagccgc agggccccct catggtgatc gtggagttct 421 gcaagtacgg caacctctcc aacttcctgc gcgccaagcg ggacgccttc agcccctgcg 481 cggagaagtc tcccgagcag cgcggacgct tccgcgccat ggtggagctc gccaggctgg 541 atcggaggcg gccggggagc agcgacaggg tcctcttcgc gcggttctcg aagaccgagg 601 gcggagcgag gcgggcttct ccagaccaag aagctgagga cctgtggctg agcccgctga 661 ccatggaaga tcttgtctgc tacagcttcc aggtggccag agggatggag ttcctggctt 721 cccgaaagtg catccacaga gacctggctg ctcggaacat tctgctgtcg gaaagcgacg 781 tggtgaagat ctgtgacttt ggccttgccc gggacatcta caaagaccct gactacgtcc 841 gcaagggcag tgcccggctg cccctgaagt ggatggcccc tgaaagcatc ttcgacaagg 901 tgtacaccac gcagagtgac gtgtggtcct ttggggtgct tctctgggag atcttctctc 961 tgggggcctc cccgtaccct ggggtgcaga tcaatgagga gttctgccag cggctgagag 1021 acggcacaag gatgagggcc ccggagctgg ccactcccgc catacgccgc atcatgctga 1081 actgctggtc cggagacccc aaggcgagac ctgcattctc ggagctggtg gagatcctgg 1141 gggacctgcT CCAGGGCAGG GGCCTGCAAG AGGAAGAGGA GGTCTGCATG GCCCCGCGCA 1201 GCTCTCAGAG CTCAGAAGAG GGCAGCTTCT CGCAGGTGTC CACCATGGCC CTACACATCG 1261 CCCAGGCTGA CGCTGAGGAC AGCCCGCCAA GCCTGCAGCG CCACAGCCTG GCCGCCAGGT 1321 ATTACAACTG GGTGTCCTTT CCCGGGTGCC TGGCCAGAGG GGCTGAGACC CGTGGTTCCT 1381 CCAGGATGAA GACATTTGAG GAATTCCCCA TGACCCCAAC GACCTACAAA GGCTCTGTGG 1441 ACAACCAGAC AGACAGTGGG ATGGTGCTGG CCTCGGAGGA GTTTGAGCAG ATAGAGAGCA 1501 GGCATAGACA AGAAAGCGGC TTCAGGTAGG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 1561 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1621 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGTTTA 1681 ATTCACAACC AGATCCGCCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1741 tgaaagatt