Transcript: Human XM_017009266.1

PREDICTED: Homo sapiens fms related tyrosine kinase 4 (FLT4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FLT4 (2324)
Length:
4883
CDS:
228..4355

Additional Resources:

NCBI RefSeq record:
XM_017009266.1
NBCI Gene record:
FLT4 (2324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149037 CTCACCTCTCACGAACACGT pXPR_003 AGG 619 15% 3 0.8071 FLT4 FLT4 75632
2 BRDN0001147213 CATACCATGCACAATGACCT pXPR_003 CGG 1204 29% 7 0.7227 FLT4 FLT4 75630
3 BRDN0001147158 GCCCTCCAGTCACGGCACTG pXPR_003 TGG 1686 41% 11 0.3268 FLT4 FLT4 75629
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009266.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256731 ACAACGGCATCCAGCGATTTC pLKO_005 1396 CDS 100% 10.800 15.120 N FLT4 n/a
2 TRCN0000256728 GGACACCCTGCAAGATGTTTG pLKO_005 1846 CDS 100% 10.800 15.120 N FLT4 n/a
3 TRCN0000000640 TGCGAATACCTGTCCTACGAT pLKO.1 2940 CDS 100% 3.000 4.200 N FLT4 n/a
4 TRCN0000000639 TCACCATCGAATCCAAGCCAT pLKO.1 2131 CDS 100% 2.640 3.696 N FLT4 n/a
5 TRCN0000199905 GCATAGACAAGAAAGCGGCTT pLKO.1 4328 CDS 100% 2.160 3.024 N FLT4 n/a
6 TRCN0000199420 CGACGGCTTCACCATCGAATC pLKO.1 2123 CDS 100% 2.000 2.800 N FLT4 n/a
7 TRCN0000256730 CACCGTGTGGGCTGAGTTTAA pLKO_005 1214 CDS 100% 13.200 9.240 N FLT4 n/a
8 TRCN0000256729 TCACAGGCAACGAGCTCTATG pLKO_005 1129 CDS 100% 10.800 7.560 N FLT4 n/a
9 TRCN0000380656 TCTGGAGGAGCAATGCGAATA pLKO_005 2927 CDS 100% 10.800 7.560 N FLT4 n/a
10 TRCN0000195141 CGCTATTTCTTCTACTGCTAT pLKO.1 4438 3UTR 100% 4.950 3.465 N FLT4 n/a
11 TRCN0000000637 GATCGTGGAGTTCTGCAAGTA pLKO.1 3233 CDS 100% 4.950 3.465 N FLT4 n/a
12 TRCN0000199669 GCGTTACTGCTTGACCAAAGA pLKO.1 4695 3UTR 100% 4.950 3.465 N FLT4 n/a
13 TRCN0000000636 GAGAGACTTTGAGCAGCCATT pLKO.1 854 CDS 100% 4.050 2.835 N FLT4 n/a
14 TRCN0000194850 CTTTAAGACTTTCGCTATTTC pLKO.1 4426 3UTR 100% 13.200 7.920 N FLT4 n/a
15 TRCN0000000638 AGCAGATAGAGAGCAGGCATA pLKO.1 4312 CDS 100% 4.050 2.430 N FLT4 n/a
16 TRCN0000267642 AGGCAGCATACGTCAGCATTT pLKO_005 4374 3UTR 100% 10.800 5.400 Y FLT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009266.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14645 pDONR223 0% 93.8% 92.8% None (many diffs) n/a
2 ccsbBroad304_14645 pLX_304 0% 93.8% 92.8% V5 (many diffs) n/a
3 TRCN0000480308 CTTATTGTCCGCAGCATTACACCC pLX_317 9.9% 93.7% 92.8% V5 (many diffs) n/a
4 TRCN0000488726 AGATAGCCACCCTGATACCAATCT pLX_317 8.3% 93.7% 92.7% V5 (many diffs) n/a
5 TRCN0000488458 TATCAAGACGGCGCCCATCTAACG pLX_317 7.8% 93.7% 92.8% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491780 GTTTAATTCACAACCAGATCCGCC pLX_317 26.3% 35% 35% V5 (not translated due to prior stop codon) 1_2679del;2865G>T;3429C>T n/a
Download CSV