Transcript: Human NM_001354989.2

Homo sapiens fms related tyrosine kinase 4 (FLT4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
FLT4 (2324)
Length:
4359
CDS:
56..3976

Additional Resources:

NCBI RefSeq record:
NM_001354989.2
NBCI Gene record:
FLT4 (2324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256731 ACAACGGCATCCAGCGATTTC pLKO_005 993 CDS 100% 10.800 15.120 N FLT4 n/a
2 TRCN0000256728 GGACACCCTGCAAGATGTTTG pLKO_005 1443 CDS 100% 10.800 15.120 N FLT4 n/a
3 TRCN0000000640 TGCGAATACCTGTCCTACGAT pLKO.1 2537 CDS 100% 3.000 4.200 N FLT4 n/a
4 TRCN0000000639 TCACCATCGAATCCAAGCCAT pLKO.1 1728 CDS 100% 2.640 3.696 N FLT4 n/a
5 TRCN0000199905 GCATAGACAAGAAAGCGGCTT pLKO.1 3925 CDS 100% 2.160 3.024 N FLT4 n/a
6 TRCN0000199420 CGACGGCTTCACCATCGAATC pLKO.1 1720 CDS 100% 2.000 2.800 N FLT4 n/a
7 TRCN0000256730 CACCGTGTGGGCTGAGTTTAA pLKO_005 811 CDS 100% 13.200 9.240 N FLT4 n/a
8 TRCN0000256729 TCACAGGCAACGAGCTCTATG pLKO_005 726 CDS 100% 10.800 7.560 N FLT4 n/a
9 TRCN0000380656 TCTGGAGGAGCAATGCGAATA pLKO_005 2524 CDS 100% 10.800 7.560 N FLT4 n/a
10 TRCN0000000637 GATCGTGGAGTTCTGCAAGTA pLKO.1 2830 CDS 100% 4.950 3.465 N FLT4 n/a
11 TRCN0000199669 GCGTTACTGCTTGACCAAAGA pLKO.1 4167 3UTR 100% 4.950 3.465 N FLT4 n/a
12 TRCN0000000636 GAGAGACTTTGAGCAGCCATT pLKO.1 451 CDS 100% 4.050 2.835 N FLT4 n/a
13 TRCN0000000638 AGCAGATAGAGAGCAGGCATA pLKO.1 3909 CDS 100% 4.050 2.430 N FLT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354989.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14645 pDONR223 0% 99.3% 99.3% None 3894_3918delinsG n/a
2 ccsbBroad304_14645 pLX_304 0% 99.3% 99.3% V5 3894_3918delinsG n/a
3 TRCN0000480308 CTTATTGTCCGCAGCATTACACCC pLX_317 9.9% 99.3% 99.3% V5 3894_3918del n/a
4 TRCN0000488726 AGATAGCCACCCTGATACCAATCT pLX_317 8.3% 99.3% 99.3% V5 (many diffs) n/a
5 TRCN0000488458 TATCAAGACGGCGCCCATCTAACG pLX_317 7.8% 99.2% 99.3% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491780 GTTTAATTCACAACCAGATCCGCC pLX_317 26.3% 36.8% 36.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV