Construct: ORF TRCN0000491788
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003286.1_s317c1
- Derived from:
- ccsbBroadEn_07420
- DNA Barcode:
- CTGTTATTCTAACAAGTGATGTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FHL5 (9457)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491788
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9457 | FHL5 | four and a half LIM domains 5 | NM_001170807.2 | 99.7% | 99.2% | 572G>A;631G>A |
2 | human | 9457 | FHL5 | four and a half LIM domains 5 | NM_001322466.1 | 99.7% | 99.2% | 572G>A;631G>A |
3 | human | 9457 | FHL5 | four and a half LIM domains 5 | NM_001322467.1 | 99.7% | 99.2% | 572G>A;631G>A |
4 | human | 9457 | FHL5 | four and a half LIM domains 5 | NM_020482.5 | 99.7% | 99.2% | 572G>A;631G>A |
5 | mouse | 57756 | Fhl5 | four and a half LIM domains 5 | NM_021318.3 | 86% | 84.8% | (many diffs) |
6 | mouse | 57756 | Fhl5 | four and a half LIM domains 5 | XM_011250080.2 | 86% | 84.8% | (many diffs) |
7 | mouse | 57756 | Fhl5 | four and a half LIM domains 5 | XM_006538125.3 | 83.1% | 81.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 918
- ORF length:
- 852
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac aactgctcac ttttactgtc aatactgcac agcatcactt cttgggaaga 121 aatatgtact aaaggatgac agtccatact gtgttacatg ttatgatcgt gtattttcta 181 actattgcga ggaatgcaaa aaaccaattg aatctgattc taaggatctt tgttacaaag 241 accggcactg gcatgaagga tgcttcaagt gcaccaaatg caatcactct ttggtggaaa 301 agccttttgc tgccaaggat gagcgcctgc tgtgcacgga gtgctattct aacgagtgct 361 cctccaagtg cttccactgc aagaggacca tcatgcctgg ttcccgcaaa atggaattta 421 agggaaacta ctggcatgaa acctgttttg tgtgtgagaa ttgccgacaa cctataggga 481 caaagccttt gaTCTCCAAA GAGAGTGGCA ATTATTGTGT GCCATGTTTT GAGAAGGAGT 541 TTGCTCACTA CTGCAACTTT TGTAAGAAGG TGATAACTTC AGGTGGGATA ACATTTTGTG 601 ACCAGCTATG GCATAAAGAG TGTTTTCTGT GTAGTGACTG TAGGAAAGAT CTCTGTGAAG 661 AACAGTTCAT GTCCAGAGAC GACTATCCAT TCTGCATGGA CTGCTACAAC CATCTTTATG 721 CCAACAAGTG TGTAGCCTGT TCCAAACCCA TTAGTGGTCT CACAGGTGCC AAGTTTATCT 781 GCTTTCAAGA CAGCCAGTGG CATAGCGAAT GCTTTAACTG CGGGAAATGC TCTGTCTCCT 841 TGGTGGGTAA AGGCTTCCTG ACCCAGAACA AGGAAATCTT CTGCCAAAAA TGTGGCTCCG 901 GAATGGACAC TGACATCTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 961 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1021 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACTGTTAT TCTAACAAGT 1081 GATGTCTACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt