Transcript: Mouse NM_021318.3

Mus musculus four and a half LIM domains 5 (Fhl5), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Fhl5 (57756)
Length:
1135
CDS:
182..1036

Additional Resources:

NCBI RefSeq record:
NM_021318.3
NBCI Gene record:
Fhl5 (57756)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021318.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113485 GCAATTATTGTGTGCCATGTT pLKO.1 624 CDS 100% 4.950 6.930 N Fhl5 n/a
2 TRCN0000113486 CCCATAACATGGAAATCTTAT pLKO.1 978 CDS 100% 13.200 9.240 N Fhl5 n/a
3 TRCN0000113489 GAGCAGTGTAAAGAACCAATT pLKO.1 305 CDS 100% 10.800 7.560 N Fhl5 n/a
4 TRCN0000113488 GCCAAGTTCATCTGCTTTCAA pLKO.1 884 CDS 100% 5.625 3.938 N Fhl5 n/a
5 TRCN0000113487 GTGGCAATTATTGTGTGCCAT pLKO.1 621 CDS 100% 0.264 0.185 N Fhl5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021318.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07420 pDONR223 100% 86% 84.8% None (many diffs) n/a
2 ccsbBroad304_07420 pLX_304 0% 86% 84.8% V5 (many diffs) n/a
3 TRCN0000491788 CTGTTATTCTAACAAGTGATGTCT pLX_317 50% 86% 84.8% V5 (many diffs) n/a
Download CSV