Transcript: Human NM_001170807.2

Homo sapiens four and a half LIM domains 5 (FHL5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
FHL5 (9457)
Length:
3923
CDS:
209..1063

Additional Resources:

NCBI RefSeq record:
NM_001170807.2
NBCI Gene record:
FHL5 (9457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001170807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432413 GAACTCAGTTGCGGTCTTATT pLKO_005 1118 3UTR 100% 13.200 18.480 N FHL5 n/a
2 TRCN0000428333 GAGAATTGCCGACAACCTATA pLKO_005 599 CDS 100% 10.800 15.120 N FHL5 n/a
3 TRCN0000428589 TCATGTCCAGAGACGACTATC pLKO_005 810 CDS 100% 10.800 15.120 N FHL5 n/a
4 TRCN0000113485 GCAATTATTGTGTGCCATGTT pLKO.1 651 CDS 100% 4.950 3.960 N Fhl5 n/a
5 TRCN0000147322 GTCCATACTGTGTTACATGTT pLKO.1 285 CDS 100% 4.950 3.960 N FHL5 n/a
6 TRCN0000417325 TTTGCCTTCGTTGTCACTAAA pLKO_005 1093 3UTR 100% 13.200 9.240 N FHL5 n/a
7 TRCN0000423210 ATCTGATTCTAAGGATCTTTG pLKO_005 355 CDS 100% 10.800 7.560 N FHL5 n/a
8 TRCN0000416916 ATGCTTTAACTGCGGGAAATG pLKO_005 952 CDS 100% 10.800 7.560 N FHL5 n/a
9 TRCN0000147430 GAGATCAAACTGAGAGGTATA pLKO.1 1421 3UTR 100% 10.800 7.560 N FHL5 n/a
10 TRCN0000424487 GATGCTTCAAGTGCACCAAAT pLKO_005 402 CDS 100% 10.800 7.560 N FHL5 n/a
11 TRCN0000146618 CTTTATGCCAACAAGTGTGTA pLKO.1 857 CDS 100% 4.950 3.465 N FHL5 n/a
12 TRCN0000147411 GCTATGGCATAAAGAGTGTTT pLKO.1 748 CDS 100% 4.950 3.465 N FHL5 n/a
13 TRCN0000113487 GTGGCAATTATTGTGTGCCAT pLKO.1 648 CDS 100% 0.264 0.185 N Fhl5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07420 pDONR223 100% 99.7% 99.2% None 572G>A;631G>A n/a
2 ccsbBroad304_07420 pLX_304 0% 99.7% 99.2% V5 572G>A;631G>A n/a
3 TRCN0000491788 CTGTTATTCTAACAAGTGATGTCT pLX_317 50% 99.7% 99.2% V5 572G>A;631G>A n/a
Download CSV