Construct: ORF TRCN0000491833
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011161.1_s317c1
- Derived from:
- ccsbBroadEn_03805
- DNA Barcode:
- ATCAAACTGGTCTTATCCTTACAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NIPAL3 (57185)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491833
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322854.1 | 100% | 100% | |
| 2 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322855.1 | 100% | 100% | |
| 3 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322856.1 | 100% | 100% | |
| 4 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322857.1 | 100% | 100% | |
| 5 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_020448.5 | 100% | 100% | |
| 6 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322866.1 | 97.7% | 97.7% | 66_67ins27 |
| 7 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | XM_011541808.2 | 94.2% | 92.9% | (many diffs) |
| 8 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322864.1 | 92.4% | 92.2% | (many diffs) |
| 9 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001330409.1 | 88.5% | 84.3% | (many diffs) |
| 10 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | XM_017001869.1 | 88.5% | 84.3% | (many diffs) |
| 11 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322868.1 | 87.4% | 87.4% | 773_774ins153 |
| 12 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | XM_017001868.1 | 81.4% | 76.9% | (many diffs) |
| 13 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322862.1 | 79.8% | 79.8% | 0_1ins246 |
| 14 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322863.1 | 79.8% | 79.8% | 0_1ins246 |
| 15 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322858.1 | 60.3% | 60.3% | 0_1ins483 |
| 16 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322859.1 | 60.3% | 60.3% | 0_1ins483 |
| 17 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322860.1 | 60.3% | 60.3% | 0_1ins483 |
| 18 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322861.1 | 60.3% | 60.3% | 0_1ins483 |
| 19 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NM_001322865.2 | 54.6% | 52.1% | (many diffs) |
| 20 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NR_136506.1 | 20.6% | 1_412del;950_951ins97;1534_5334del | |
| 21 | human | 57185 | NIPAL3 | NIPA like domain containing 3 | NR_136508.1 | 19.9% | 1_412del;1049_1050ins136;1495_5295del | |
| 22 | mouse | 74552 | Nipal3 | NIPA-like domain containing 3 | NM_028995.3 | 85.6% | 89% | (many diffs) |
| 23 | mouse | 74552 | Nipal3 | NIPA-like domain containing 3 | XM_017320417.1 | 85.6% | 89% | (many diffs) |
| 24 | mouse | 74552 | Nipal3 | NIPA-like domain containing 3 | XM_006539231.1 | 73.2% | 76% | (many diffs) |
| 25 | mouse | 74552 | Nipal3 | NIPA-like domain containing 3 | XM_006539232.1 | 72.9% | 75.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1284
- ORF length:
- 1218
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cggatcccac agcgcagccc tgaagctgca gcagctgcct cccacaagta 121 gctccagcgc cgtaagcgag gcctccttct cctacaagga aaacctgatt ggcgccctct 181 tggcgatctt cgggcacctc gtggtcagca ttgcacttaa cctccagaag tactgccaca 241 tccgcctggc aggctccaag gatccccggg cctatttcaa gaccaagaca tggtggctgg 301 gcctgttcct gatgcttctg ggcgagctgg gtgtgttcgc ctcctacgcc ttcgcgccgc 361 tgtcactcat cgtgcccctc agcgcagttt ctgtgatagc tagtgccatc ataggaatca 421 tattcatcaa ggaaaagtgg aaaccgaaag actttctgag gcgctacgtc ttgtcctttg 481 ttggctgcgg tttggctgtc gtgggtacct acctgctggt gacattcgca cccaacagtc 541 acgagaagat gacaggcgag aatgtcacca ggcacctcgt gagctggcct ttccttttgt 601 acatgctggt ggagatcatt ctgttctgct tgctgctcta cttctacaag gagaagaacg 661 ccaacaacat tgtcgtgatt cttctcttgg tggcgttact tggctccatg acagtggtga 721 cagtcaaggc cgtggctggg atgcttgtct tgtccattca agggaacctg cagcttgact 781 accccatctt ctacgtgatg ttcgtgtgca tggtggcaac cgccgtctat caggctgcgt 841 ttttgagtca agcctcacag atgtacgact cctctttgat tgccagtgtg ggcTACATTC 901 TGTCCACAAC CATTGCTATC ACAGCAGGTG CAATATTTTA CCTGGACTTC ATCGGGGAGG 961 ACGTGCTGCA CATCTGCATG TTTGCACTGG GGTGCCTCAT TGCATTCTTG GGCGTCTTCT 1021 TAATCACGCG TAACAGGAAG AAGCCCATTC CATTTGAGCC CTATATTTCC ATGGATGCCA 1081 TGCCAGGTAT GCAGAACATG CACGATAAAG GGATGACTGT CCAGCCTGAA CTTAAAGCTT 1141 CTTTTTCCTA TGGGGCTCTG GAAAACAATG ACAACATTTC TGAGATCTAC GCTCCTGCCA 1201 CCCTGCCAGT CATGCAAGAA GAGCACGGCT CCAGAAGTGC CTCTGGGGTC CCCTACCGAG 1261 TCCTAGAGCA CACCAAGAAG GAATGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1321 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1381 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA TCAAACTGGT 1441 CTTATCCTTA CAAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1501 att