Transcript: Human NM_001322859.1

Homo sapiens NIPA like domain containing 3 (NIPAL3), transcript variant 7, mRNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
NIPAL3 (57185)
Length:
5190
CDS:
655..1392

Additional Resources:

NCBI RefSeq record:
NM_001322859.1
NBCI Gene record:
NIPAL3 (57185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435198 GGTTCAACCCTGAATCCTAAA pLKO_005 1438 3UTR 100% 10.800 15.120 N NIPAL3 n/a
2 TRCN0000138300 CGCTACGTCTTGTCCTTTGTT pLKO.1 568 5UTR 100% 5.625 7.875 N NIPAL3 n/a
3 TRCN0000419159 TGCAGAACATGCACGATAAAG pLKO_005 1196 CDS 100% 13.200 10.560 N NIPAL3 n/a
4 TRCN0000167984 CCAATCTTTGTCCAGTGGTAT pLKO.1 4536 3UTR 100% 4.950 3.465 N NIPAL3 n/a
5 TRCN0000138410 CATTGCATTCTTGGGCGTCTT pLKO.1 1104 CDS 100% 4.050 2.835 N NIPAL3 n/a
6 TRCN0000138687 GAAAGACTTTCTGAGGCGCTA pLKO.1 552 5UTR 100% 2.160 1.512 N NIPAL3 n/a
7 TRCN0000167109 CCAGTGTGATAGATCACTTAT pLKO.1 2902 3UTR 100% 13.200 7.920 N NIPAL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03805 pDONR223 100% 60.3% 60.3% None 0_1ins483 n/a
2 ccsbBroad304_03805 pLX_304 0% 60.3% 60.3% V5 0_1ins483 n/a
3 TRCN0000491833 ATCAAACTGGTCTTATCCTTACAA pLX_317 32.3% 60.3% 60.3% V5 0_1ins483 n/a
4 ccsbBroadEn_15943 pDONR223 0% 15% 13.1% None (many diffs) n/a
5 ccsbBroad304_15943 pLX_304 0% 15% 13.1% V5 (many diffs) n/a
6 TRCN0000467451 TCGGCCCATTGCACAGCGAACAAC pLX_317 59.1% 15% 13.1% V5 (many diffs) n/a
Download CSV