Construct: ORF TRCN0000491867
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017149.1_s317c1
- Derived from:
- ccsbBroadEn_08911
- DNA Barcode:
- ACCCCTATTTCCACAGGCGTGGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PVRIG (79037)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491867
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79037 | PVRIG | PVR related immunoglobulin ... | NM_024070.3 | 99.8% | 99.6% | 241A>G |
| 2 | human | 79037 | PVRIG | PVR related immunoglobulin ... | XM_011516575.2 | 99.8% | 99.6% | 241A>G |
| 3 | human | 101752334 | PVRIG2P | poliovirus receptor related... | NR_103728.1 | 73.5% | (many diffs) | |
| 4 | human | 101752399 | STAG3L5P-PVRIG2P-PILRB | STAG3L5P-PVRIG2P-PILRB read... | NR_036570.1 | 28.9% | (many diffs) | |
| 5 | human | 101752399 | STAG3L5P-PVRIG2P-PILRB | STAG3L5P-PVRIG2P-PILRB read... | NR_036569.1 | 22.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1044
- ORF length:
- 978
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag aacagaggca caggtgccgg ccctgcagcc cccagaacct ggactggagg 121 gggccatggg gcaccggacc ctggtcctgc cctgggtgct gctgaccttg tgtgtcactg 181 cggggacccc ggaggtgtgg gttcaagttc ggatggaggc caccgagctc tcgtccttca 241 ccatccgttg tgggttcctg gggtctggct ccatctccct ggtgactgtg agctgggggg 301 gccccgacgg tgctgggggg accacgctgg ctgtgttgca cccagaacgt ggcatccggc 361 aatgggcccc tgctcgccag gcccgctggg aaacccagag cagcatctct ctcatcctgg 421 aaggctctgg ggccagcagc ccctgcgcca acaccacctt ctgctgcaag tttgcgtcct 481 tccctgaggg ctcctgggag gcctgtggga gcctcccgcc cagctcagac ccagggctct 541 ctgccccgcc gactcctgcc cccattctgc gggcagacct ggccgggatc ttgggggtct 601 caggagtcct cctctttggc tgtgtctacc tccttcatct gcTGCGCCGA CATAAGCACC 661 GCCCTGCCCC TAGGCTCCAG CCGTCCCGCA CCAGCCCCCA GGCACCGAGA GCACGAGCAT 721 GGGCACCAAG CCAGGCCTCC CAGGCTGCTC TTCACGTCCC TTATGCCACT ATCAACACCA 781 GCTGCCGCCC AGCTACTTTG GACACAGCTC ACCCCCATGG GGGGCCGTCC TGGTGGGCGT 841 CACTCCCCAC CCACGCTGCA CACCGGCCCC AGGGCCCTGC CGCCTGGGCC TCCACACCCA 901 TCCCTGCACG TGGCAGCTTT GTCTCTGTTG AGAATGGACT CTACGCTCAG GCAGGGGAGA 961 GGCCTCCTCA CACTGGTCCC GGCCTCACTC TTTTCCCTGA CCCTCGGGGG CCCAGGGCCA 1021 TGGAAGGACC CTTAGGAGTT CGATGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1081 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1141 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CCCCTATTTC 1201 CACAGGCGTG GATACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1261 att