Transcript: Human NM_024070.3

Homo sapiens PVR related immunoglobulin domain containing (PVRIG), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
PVRIG (79037)
Length:
1587
CDS:
352..1332

Additional Resources:

NCBI RefSeq record:
NM_024070.3
NBCI Gene record:
PVRIG (79037)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024070.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180104 CCTCCAATAAGTGTCCCATAG pLKO.1 1407 3UTR 100% 6.000 4.200 N PVRIG n/a
2 TRCN0000182928 CTTACTTTAATTCTTGGGCCT pLKO.1 1389 3UTR 100% 0.540 0.378 N PVRIG n/a
3 TRCN0000179418 CAGCTTTGTCTCTGTTGAGAA pLKO.1 1200 CDS 100% 4.950 2.475 Y PVRIG n/a
4 TRCN0000180755 GCAGCTTTGTCTCTGTTGAGA pLKO.1 1199 CDS 100% 3.000 1.500 Y PVRIG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024070.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04033 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04033 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480456 CGAGCAGACCACGCTGTCTAACAA pLX_317 38.4% 100% 100% V5 n/a
4 ccsbBroadEn_08911 pDONR223 100% 99.8% 99.6% None 241A>G n/a
5 ccsbBroad304_08911 pLX_304 0% 99.8% 99.6% V5 241A>G n/a
6 TRCN0000491867 ACCCCTATTTCCACAGGCGTGGAT pLX_317 41.2% 99.8% 99.6% V5 241A>G n/a
Download CSV