Construct: ORF TRCN0000491893
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020869.2_s317c1
- DNA Barcode:
- GCTTTAGCACGCGGGGGTTGGAAG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- P2RY2 (5029)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491893
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | NM_002564.4 | 99.8% | 99.7% | 137C>T;816C>T |
| 2 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | NM_176071.3 | 99.8% | 99.7% | 137C>T;816C>T |
| 3 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | NM_176072.3 | 99.8% | 99.7% | 137C>T;816C>T |
| 4 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_005274019.4 | 99.8% | 99.7% | 137C>T;816C>T |
| 5 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_005274020.4 | 99.8% | 99.7% | 137C>T;816C>T |
| 6 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_005274021.4 | 99.8% | 99.7% | 137C>T;816C>T |
| 7 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_011545074.2 | 99.8% | 99.7% | 137C>T;816C>T |
| 8 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_017017839.1 | 99.8% | 99.7% | 137C>T;816C>T |
| 9 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XR_001747891.1 | 53.8% | (many diffs) | |
| 10 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XR_001747890.1 | 46% | (many diffs) | |
| 11 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XR_001747892.1 | 34.9% | (many diffs) | |
| 12 | mouse | 18442 | P2ry2 | purinergic receptor P2Y, G-... | NM_001302346.1 | 84.6% | 89.6% | (many diffs) |
| 13 | mouse | 18442 | P2ry2 | purinergic receptor P2Y, G-... | NM_001302347.1 | 84.6% | 89.6% | (many diffs) |
| 14 | mouse | 18442 | P2ry2 | purinergic receptor P2Y, G-... | NM_008773.4 | 84.6% | 89.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1203
- ORF length:
- 1131
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcagca gacctgggcc cctggaatga caccatcaat ggcacctggg 121 atggggatga gctgggctac aggtgccgct tcaacgagga cttcaagtac gtgctgctgc 181 ctgtgtccta cggcgtggtg tgcgtgcttg ggctgtgtct gaacgccgtg gcgctctaca 241 tcttcttgtg ccgcctcaag acctggaatg cgtccaccac atatatgttc cacctggctg 301 tgtctgatgc actgtatgcg gcctccctgc cgctgctggt ctattactac gcccgcggcg 361 accactggcc cttcagcacg gtgctctgca agctggtgcg cttcctcttc tacaccaacc 421 tttactgcag catcctcttc ctcacctgca tcagcgtgca ccggtgtctg ggcgtcttac 481 gacctctgcg ctccctgcgc tggggccggg cccgctacgc tcgccgggtg gccggggccg 541 tgtgggtgtt ggtgctggcc tgccaggccc ccgtgctcta ctttgtcacc accagcgcgc 601 gcgggggccg cgtaacctgc cacgacacct cggcacccga gctcttcagc cgcttcgtgg 661 cctacagctc agtcatgctg ggcctgctct tcgcggtgcc ctttgccgtc atccttgtct 721 gttacgtgct catggctcgg cgactgctaa agccagccta cgggacctcg ggcggcctgc 781 ctagggccaa gcgcaagtcc gtgcgcacca tcgccgtggt gctggctgtc ttcgccctct 841 gcttcctgcc attccacgtc acccgcaccc tcTACTACTC CTTCCGTTCG CTGGACCTCA 901 GCTGCCACAC CCTCAACGCC ATCAACATGG CCTACAAGGT TACCCGGCCG CTGGCCAGTG 961 CTAACAGTTG CCTTGACCCC GTGCTCTACT TCCTGGCTGG GCAGAGGCTC GTACGCTTTG 1021 CCCGAGATGC CAAGCCACCC ACTGGCCCCA GCCCTGCCAC CCCGGCTCGC CGCAGGCTGG 1081 GCCTGCGCAG ATCCGACAGA ACTGACATGC AGAGGATAGA AGATGTGTTG GGCAGCAGTG 1141 AGGACTCTAG GCGGACAGAG TCCACGCCGG CTGGTAGCGA GAACACTAAG GACATTCGGC 1201 TGTAGGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1261 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1321 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGCTTTAGCA CGCGGGGGTT GGAAGACGCG 1381 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt