Construct: ORF TRCN0000491913
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020914.2_s317c1
- DNA Barcode:
- TTAGCCGGGGAGATTTGATCATAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- ADCYAP1R1 (117)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491913
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 117 | ADCYAP1R1 | ADCYAP receptor type I | NM_001199635.1 | 100% | 100% | |
| 2 | human | 117 | ADCYAP1R1 | ADCYAP receptor type I | NM_001199636.2 | 99.7% | 99.7% | 1046_1047insCAG |
| 3 | human | 117 | ADCYAP1R1 | ADCYAP receptor type I | XM_017011736.2 | 98.5% | 98.5% | 264_265ins21 |
| 4 | human | 117 | ADCYAP1R1 | ADCYAP receptor type I | XM_006715645.3 | 95.7% | 94% | (many diffs) |
| 5 | human | 117 | ADCYAP1R1 | ADCYAP receptor type I | XM_017011737.2 | 95.7% | 95.7% | 263_264ins63 |
| 6 | human | 117 | ADCYAP1R1 | ADCYAP receptor type I | NM_001118.5 | 94.3% | 94.3% | 1045_1046ins84 |
| 7 | human | 117 | ADCYAP1R1 | ADCYAP receptor type I | NM_001199637.2 | 90.1% | 90.1% | 263_264ins63;982_983ins84 |
| 8 | human | 117 | ADCYAP1R1 | ADCYAP receptor type I | XM_017011738.2 | 88.5% | 88.5% | 154_155ins171 |
| 9 | human | 117 | ADCYAP1R1 | ADCYAP receptor type I | XM_005249618.5 | 82.8% | 82.8% | 154_155ins171;874_875ins84 |
| 10 | mouse | 11517 | Adcyap1r1 | adenylate cyclase activatin... | NM_007407.4 | 88.9% | 93.1% | (many diffs) |
| 11 | mouse | 11517 | Adcyap1r1 | adenylate cyclase activatin... | XM_011241152.2 | 88.7% | 92.9% | (many diffs) |
| 12 | mouse | 11517 | Adcyap1r1 | adenylate cyclase activatin... | XM_006505388.2 | 84.3% | 88.1% | (many diffs) |
| 13 | mouse | 11517 | Adcyap1r1 | adenylate cyclase activatin... | XM_011241150.1 | 84.3% | 88.1% | (many diffs) |
| 14 | mouse | 11517 | Adcyap1r1 | adenylate cyclase activatin... | NM_001025372.2 | 83.3% | 87.5% | (many diffs) |
| 15 | mouse | 11517 | Adcyap1r1 | adenylate cyclase activatin... | XM_011241151.1 | 81.2% | 85.4% | (many diffs) |
| 16 | mouse | 11517 | Adcyap1r1 | adenylate cyclase activatin... | XM_011241153.2 | 80.1% | 84.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1560
- ORF length:
- 1488
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggctggt gtcgtgcacg tttccctggc tgctctcctc ctgctgccta 121 tggcccctgc catgcattct gactgcatct tcaagaagga gcaagccatg tgcctggaga 181 agatccagag ggccaatgag ctgatgggct tcaatgattc ctctccaggc tgtcctggga 241 tgtgggacaa catcacgtgt tggaagcccg cccatgtggg tgagatggtc ctggtcagct 301 gccctgagct cttccgaatc ttcaacccag accaagtctg ggagaccgaa accattggag 361 agtctgattt tggtgacagt aactccttag atctctcaga catgggagtg gtgagccgga 421 actgcacgga ggatggctgg tcggaaccct tccctcatta ctttgatgcc tgtgggtttg 481 atgaatatga atctgagact ggggaccagg attattacta cctgtcagtg aaggccctct 541 acacggttgg ctacagcaca tccctcgtca ccctcaccac tgccatggtc atcctttgtc 601 gcttccggaa gctgcactgc acacgcaact tcatccacat gaacctgttt gtgtcgttca 661 tgctgagggc gatctccgtc ttcatcaaag actggattct gtatgcggag caggacagca 721 accactgctt catctccact gtggaatgta aggccgtcat ggttttcttc cactactgtg 781 ttgtgtccaa ctacttctgg ctgttcatcg agggcctgta cctcttcact ctgctggtgg 841 agaccttctt ccctgaaagg agatacttct actggtacac catcattggc tgggggaccc 901 caactgtgtg tgtgacagtg tgggctacgc tgagactcta ctttgatgac acaggctgct 961 gggatatgaa tgacagcaca gctctgtggt gggtgatcaa aggccctgtg gttggctcta 1021 tcatggttaa ctttgtgctt tttattggca ttatcgtcat ccttgtgcag aaacttcagt 1081 ctccagacat gggaggcaat gagtccagca tctacttcag ctgcgtgcag aaatgctact 1141 gcaagccaca gcgggctcag cagcactctt gcaagatGTC AGAACTGTCC ACCATTACTC 1201 TGCGACTGGC CCGGTCCACC CTGCTGCTCA TCCCACTATT CGGAATCCAC TACACAGTAT 1261 TTGCCTTCTC CCCAGAGAAT GTCAGCAAAA GGGAAAGACT CGTGTTTGAG CTGGGGCTGG 1321 GCTCCTTCCA GGGCTTTGTG GTGGCTGTTC TCTACTGTTT TCTGAATGGT GAGGTACAAG 1381 CGGAGATCAA GCGAAAATGG CGAAGCTGGA AGGTGAACCG TTACTTCGCT GTGGACTTCA 1441 AGCACCGACA CCCGTCTCTG GCCAGCAGTG GGGTGAATGG GGGCACCCAG CTCTCCATCC 1501 TGAGCAAGAG CAGCTCCCAA ATCCGCATGT CTGGCCTCCC TGCTGACAAT CTGGCCACCT 1561 AGGACCCAGC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1621 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1681 GGCTTTATAT ATCTTGTGGA AAGGACGATT AGCCGGGGAG ATTTGATCAT AAACGCGTTA 1741 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt