Transcript: Mouse NM_007407.4

Mus musculus adenylate cyclase activating polypeptide 1 receptor 1 (Adcyap1r1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Adcyap1r1 (11517)
Length:
6262
CDS:
471..1961

Additional Resources:

NCBI RefSeq record:
NM_007407.4
NBCI Gene record:
Adcyap1r1 (11517)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007407.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027364 CGTGCAGAAATGCTACTGCAA pLKO.1 1523 CDS 100% 0.264 0.370 N Adcyap1r1 n/a
2 TRCN0000027348 GCCCTGTAGTTGGCTCTATAA pLKO.1 1402 CDS 100% 13.200 10.560 N Adcyap1r1 n/a
3 TRCN0000027321 GCCTGCTCAAATAGGTGAGAT pLKO.1 665 CDS 100% 4.950 3.960 N Adcyap1r1 n/a
4 TRCN0000027326 CCGTAACTTCATCCACATGAA pLKO.1 1022 CDS 100% 0.495 0.396 N Adcyap1r1 n/a
5 TRCN0000027392 CCGTTACTTCACTATGGACTT pLKO.1 1817 CDS 100% 4.050 2.835 N Adcyap1r1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007407.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491913 TTAGCCGGGGAGATTTGATCATAA pLX_317 26.1% 88.9% 93.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487865 GATGTGGCTGGACCTGTTTAAGAT pLX_317 20.2% 88.8% 92.9% V5 (many diffs) n/a
Download CSV