Transcript: Human XM_017011738.2

PREDICTED: Homo sapiens ADCYAP receptor type I (ADCYAP1R1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADCYAP1R1 (117)
Length:
6519
CDS:
410..1729

Additional Resources:

NCBI RefSeq record:
XM_017011738.2
NBCI Gene record:
ADCYAP1R1 (117)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011738.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008028 CGGAATCCACTACACAGTATT pLKO.1 1408 CDS 100% 13.200 18.480 N ADCYAP1R1 n/a
2 TRCN0000356655 CGATCTCCGTCTTCATCAAAG pLKO_005 837 CDS 100% 10.800 15.120 N ADCYAP1R1 n/a
3 TRCN0000356658 CTACGCTGAGACTCTACTTTG pLKO_005 1092 CDS 100% 10.800 15.120 N ADCYAP1R1 n/a
4 TRCN0000008031 GCTACGCTGAGACTCTACTTT pLKO.1 1091 CDS 100% 5.625 7.875 N ADCYAP1R1 n/a
5 TRCN0000356656 GTCGGAACCCTTCCCTCATTA pLKO_005 607 CDS 100% 13.200 10.560 N ADCYAP1R1 n/a
6 TRCN0000008030 CCCACTATTCGGAATCCACTA pLKO.1 1399 CDS 100% 4.050 3.240 N ADCYAP1R1 n/a
7 TRCN0000027364 CGTGCAGAAATGCTACTGCAA pLKO.1 1291 CDS 100% 0.264 0.211 N Adcyap1r1 n/a
8 TRCN0000356594 GTTGGCTCTATCATGGTTAAC pLKO_005 1178 CDS 100% 10.800 7.560 N ADCYAP1R1 n/a
9 TRCN0000008029 GCATTCTGACTGCATCTTCAA pLKO.1 472 CDS 100% 4.950 3.465 N ADCYAP1R1 n/a
10 TRCN0000011224 CGTCTTCATCAAAGACTGGAT pLKO.1 844 CDS 100% 0.264 0.185 N ADCYAP1R1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011738.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491913 TTAGCCGGGGAGATTTGATCATAA pLX_317 26.1% 88.5% 88.5% V5 (not translated due to prior stop codon) 154_155ins171 n/a
2 TRCN0000487865 GATGTGGCTGGACCTGTTTAAGAT pLX_317 20.2% 88.4% 88.3% V5 154_155ins171;1317_1318insG n/a
Download CSV