Construct: ORF TRCN0000491958
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019545.2_s317c1
- DNA Barcode:
- ACCGACTCTGATCATCTCTTGAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CHRM3 (1131)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491958
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1131 | CHRM3 | cholinergic receptor muscar... | NM_000740.3 | 99.9% | 99.8% | 1770_1771insG |
2 | human | 1131 | CHRM3 | cholinergic receptor muscar... | NM_001347716.2 | 99.9% | 99.8% | 1770_1771insG |
3 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_005273032.3 | 99.9% | 99.8% | 1770_1771insG |
4 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_011544041.2 | 99.9% | 99.8% | 1770_1771insG |
5 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_011544043.2 | 99.9% | 99.8% | 1770_1771insG |
6 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_011544044.2 | 99.9% | 99.8% | 1770_1771insG |
7 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_011544046.2 | 99.9% | 99.8% | 1770_1771insG |
8 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_011544047.2 | 99.9% | 99.8% | 1770_1771insG |
9 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000152.2 | 99.9% | 99.8% | 1770_1771insG |
10 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000153.1 | 99.9% | 99.8% | 1770_1771insG |
11 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000154.1 | 99.9% | 99.8% | 1770_1771insG |
12 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000155.1 | 99.9% | 99.8% | 1770_1771insG |
13 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000156.1 | 99.9% | 99.8% | 1770_1771insG |
14 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000157.2 | 99.9% | 99.8% | 1770_1771insG |
15 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000158.1 | 99.9% | 99.8% | 1770_1771insG |
16 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000159.1 | 99.9% | 99.8% | 1770_1771insG |
17 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000160.2 | 99.9% | 99.8% | 1770_1771insG |
18 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000161.1 | 99.9% | 99.8% | 1770_1771insG |
19 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000162.1 | 99.9% | 99.8% | 1770_1771insG |
20 | human | 1131 | CHRM3 | cholinergic receptor muscar... | XM_017000163.2 | 99.9% | 99.8% | 1770_1771insG |
21 | mouse | 12671 | Chrm3 | cholinergic receptor, musca... | NM_033269.4 | 86.9% | 91.5% | (many diffs) |
22 | mouse | 12671 | Chrm3 | cholinergic receptor, musca... | XM_006516468.3 | 86.9% | 91.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 75
- ORF end:
- 1848
- ORF length:
- 1773
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcgc caccatgacc ttgcacaata acagtacaac ctcgcctttg tttccaaaca 121 tcagctcctc ctggatacac agcccctccg atgcagggct gcccccggga accgtcactc 181 atttcggcag ctacaatgtt tctcgagcag ctggcaattt ctcctctcca gacggtacca 241 ccgatgaccc tctgggaggt cataccgtct ggcaagtggt cttcatcgct ttcttaacgg 301 gcatcctggc cttggtgacc atcatcggca acatcctggt aattgtgtca tttaaggtca 361 acaagcagct gaagacggtc aacaactact tcctcttaag cctggcctgt gccgatctga 421 ttatcggggt catttcaatg aatctgttta cgacctacat catcatgaat cgatgggcct 481 tagggaactt ggcctgtgac ctctggcttg ccattgacta cgtagccagc aatgcctctg 541 ttatgaatct tctggtcatc agctttgaca gatacttttc catcacgagg ccgctcacgt 601 accgagccaa acgaacaaca aagagagccg gtgtgatgat cggtctggct tgggtcatct 661 cctttgtcct ttgggctcct gccatcttgt tctggcaata ctttgttgga aagagaactg 721 tgcctccggg agagtgcttc attcagttcc tcagtgagcc caccattact tttggcacag 781 ccatcgctgc tttttatatg cctgtcacca ttatgactat tttatactgg aggatctata 841 aggaaactga aaagcgtacc aaagagcttg ctggcctgca agcctctggg acagaggcag 901 agacagaaaa ctttgtccac cccacgggca gttctcgaag ctgcagcagt tacgaacttc 961 aacagcaaag catgaaacgc tccaacagga ggaagtatgg ccgctgccac ttctggttca 1021 caaccaagag ctggaaaccc agctccgagc agatggacca agaccacagc agcagtgaca 1081 gttggaacaa caatgatgct gctgcctccc tggagaactc cgcctcctcc gacgaggagg 1141 acattggctc cgagacgaga gccatctact ccatcgtgct caagcttccg ggtcacagca 1201 ccatcctcaa ctccaccaag ttaccctcat cggacaacct gcaggtgcct gaggaggagc 1261 tggggatggt ggacttggag aggaaagccg acaagctgca ggcccagaag agcgtggacg 1321 atggaggcag ttttccaaaa agcttctcca agcttcccat ccagctagag tcagccgtgg 1381 acacagctaa gacttctgac gtcaactcct cagtgggtaa gagcacggcc actctacctc 1441 tgtccttcaa ggaagccact ctggccaaga ggtttgctct gaagaCCAGA AGTCAGATCA 1501 CTAAGCGGAA AAGGATGTCC CTGGTCAAGG AGAAGAAAGC GGCCCAGACC CTCAGTGCGA 1561 TCTTGCTTGC CTTCATCATC ACTTGGACCC CATACAACAT CATGGTTCTG GTGAACACCT 1621 TTTGTGACAG CTGCATACCC AAAACCTTTT GGAATCTGGG CTACTGGCTG TGCTACATCA 1681 ACAGCACCGT GAACCCCGTG TGCTATGCTC TGTGCAACAA AACATTCAGA ACCACTTTCA 1741 AGATGCTGCT GCTGTGCCAG TGTGACAAAA AAAAGAGGCG CAAGCAGCAG TACCAGCAGA 1801 GACAGTCGGT CATTTTTCAC AAGCGCGCAC CCGAGCAGGC CTTGGACCCA GCTTTCTTGT 1861 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1921 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1981 GAAAGGACGA ACCGACTCTG ATCATCTCTT GAATACGCGT TAAGTCgaca atcaacctct 2041 ggattacaaa atttgtgaaa gatt