Transcript: Human XM_017000163.2

PREDICTED: Homo sapiens cholinergic receptor muscarinic 3 (CHRM3), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHRM3 (1131)
Length:
12819
CDS:
4821..6593

Additional Resources:

NCBI RefSeq record:
XM_017000163.2
NBCI Gene record:
CHRM3 (1131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000163.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011261 CCGAGCCAAACGAACAACAAA pLKO.1 5348 CDS 100% 5.625 7.875 N CHRM3 n/a
2 TRCN0000011259 CCTGGTAATTGTGTCATTTAA pLKO.1 5081 CDS 100% 15.000 10.500 N CHRM3 n/a
3 TRCN0000356835 AGCAGAGACAGTCGGTCATTT pLKO_005 6541 CDS 100% 13.200 9.240 N CHRM3 n/a
4 TRCN0000011260 CCTGTCACCATTATGACTATT pLKO.1 5547 CDS 100% 13.200 9.240 N CHRM3 n/a
5 TRCN0000356837 CTGTCACCATTATGACTATTT pLKO_005 5548 CDS 100% 13.200 9.240 N CHRM3 n/a
6 TRCN0000356836 TCGGCAACATCCTGGTAATTG pLKO_005 5071 CDS 100% 13.200 9.240 N CHRM3 n/a
7 TRCN0000011262 AGACCAGAAGTCAGATCACTA pLKO.1 6229 CDS 100% 4.950 3.465 N CHRM3 n/a
8 TRCN0000011263 GCAAAGCATGAAACGCTCCAA pLKO.1 5711 CDS 100% 2.640 1.848 N CHRM3 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3777 5UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3777 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000163.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00305 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00305 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466581 AGGTATATGTAACCTTGCGGCCAA pLX_317 22.8% 100% 100% V5 n/a
4 TRCN0000491837 TTTAGGACGTCGCGTTATCACGGT pLX_317 22.9% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000489844 ATCTCTAGAACCGTATCCGAGGAC pLX_317 22.3% 100% 100% V5 (not translated due to prior stop codon) n/a
6 TRCN0000489751 GACCACGGCGGCAACATTCCAGCA pLX_317 22.7% 99.9% 99.8% V5 1770_1771insG n/a
7 TRCN0000489887 GAACTTTCCGTTATGTCTCAATCA pLX_317 19.8% 99.9% 99.8% V5 1770_1771insG n/a
8 TRCN0000491958 ACCGACTCTGATCATCTCTTGAAT pLX_317 20.5% 99.9% 99.8% V5 1770_1771insG n/a
9 TRCN0000488345 CCCTGGTCCGTTTTCGACCTAGAC pLX_317 20% 95.3% 95.4% V5 (not translated due to prior stop codon) 1689_1770del n/a
Download CSV