Construct: ORF TRCN0000491998
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006508.1_s317c1
- Derived from:
- ccsbBroadEn_14142
- DNA Barcode:
- GAGCACACAGACTGATTCGAAATA
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZDHHC2 (51201)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491998
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51201 | ZDHHC2 | zinc finger DHHC-type palmi... | NM_016353.5 | 99.8% | 99.1% | 1091delA;1099A>C |
| 2 | human | 51201 | ZDHHC2 | zinc finger DHHC-type palmi... | XM_011544545.3 | 95.6% | 74.5% | (many diffs) |
| 3 | human | 51201 | ZDHHC2 | zinc finger DHHC-type palmi... | XM_011544544.3 | 88.9% | 69.7% | (many diffs) |
| 4 | human | 51201 | ZDHHC2 | zinc finger DHHC-type palmi... | NM_001362989.1 | 87.5% | 86.9% | 0_1ins135;956delA;964A>C |
| 5 | human | 51201 | ZDHHC2 | zinc finger DHHC-type palmi... | XM_024447177.1 | 87.5% | 86.9% | 0_1ins135;956delA;964A>C |
| 6 | human | 51201 | ZDHHC2 | zinc finger DHHC-type palmi... | NM_001362988.1 | 85.8% | 79.7% | (many diffs) |
| 7 | human | 51201 | ZDHHC2 | zinc finger DHHC-type palmi... | XM_011544548.3 | 84.5% | 83.9% | 0_1ins168;923delA;931A>C |
| 8 | human | 51201 | ZDHHC2 | zinc finger DHHC-type palmi... | XM_011544546.3 | 79.7% | 70.7% | (many diffs) |
| 9 | human | 51201 | ZDHHC2 | zinc finger DHHC-type palmi... | XM_011544549.3 | 38.3% | 21.8% | (many diffs) |
| 10 | mouse | 70546 | Zdhhc2 | zinc finger, DHHC domain co... | NM_178395.3 | 91% | 94.2% | (many diffs) |
| 11 | mouse | 70546 | Zdhhc2 | zinc finger, DHHC domain co... | XM_006509485.3 | 91% | 94.2% | (many diffs) |
| 12 | mouse | 70546 | Zdhhc2 | zinc finger, DHHC domain co... | XM_006509487.2 | 60.3% | 63.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1167
- ORF length:
- 1101
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gccctcgggc ccgggcagca gcgccaggcg gcggtgccgg cgggtgctgt 121 actggatccc ggtggtgttc atcaccctcc tgctcggctg gtcctactac gcctacgcca 181 tccagctgtg catagtgtcc atggaaaaca ctggcgaaca agttgtgtgc ctgatggcct 241 atcatctact ttttgcaatg tttgtctggt catactggaa aactatcttt acattaccaa 301 tgaatccttc aaaagaattc catctctctt atgcagagaa agatttgttg gagagagagc 361 caagaggaga agcccatcag gaagttctta ggcgagcagc caaggatctt cccatctata 421 ccaggaccat gtctggagcc atccgatact gtgacagatg ccaacttata aaaccagatc 481 gctgccatca ctgctccgtc tgtgataaat gtattttgaa gatggatcat cattgtccat 541 gggtgaacaa ttgtgttgga ttttcaaatt ataagttctt tctccttttc ttggcttatt 601 ctctgctcta ctgccttttt attgcggcaa cagatttaca gtattttatc aaattttgga 661 caaatggcct acctgatact caagccaagt tccatattat gtttttattc tttgctgcag 721 ctatgttttc tgtcagcttg tcttctctgt ttggctatca ttgttggcta gtcagcaaaa 781 ataaatctac attAGAGGCA TTCAGAAGTC CAGTATTTCG ACATGGAACA GATAAGAATG 841 GATTCAGCTT GGGTTTCAGT AAAAACATGC GACAAGTTTT TGGTGATGAG AAGAAGTACT 901 GGTTGCTACC CATTTTTTCA AGTCTAGGTG ATGGCTGCTC CTTTCCAACT TGCCTTGTTA 961 ACCAGGATCC TGAACAAGCA TCTACTCCTG CAGGGCTGAA TTCCACAGCT AAAAATCTCG 1021 AAAACCATCA GTTTCCTGCA AAGCCATTGA GAGAGTCCCA GAGCCACCTT CTTACTGATT 1081 CTCAGTCTTG GACGGAGAGC AGCATAAACC CAGGAAAATG CAAAGCTGGT ATGAGCAATC 1141 CTGCATTAAC CATGGAAATG AGCCTTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG 1201 TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA 1261 ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG AGAGCACACA 1321 GACTGATTCG AAATAACGCG TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa 1381 agatt