Transcript: Human XM_011544544.3

PREDICTED: Homo sapiens zinc finger DHHC-type palmitoyltransferase 2 (ZDHHC2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC2 (51201)
Length:
12416
CDS:
693..1931

Additional Resources:

NCBI RefSeq record:
XM_011544544.3
NBCI Gene record:
ZDHHC2 (51201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121854 GCTCCGTCTGTGATAAATGTA pLKO.1 1255 CDS 100% 5.625 7.875 N ZDHHC2 n/a
2 TRCN0000144269 CTTTCCAACTTGCCTTGTTAA pLKO.1 1703 CDS 100% 13.200 9.240 N ZDHHC2 n/a
3 TRCN0000144583 GTATGAGCAATCCTGCATTAA pLKO.1 1891 CDS 100% 13.200 9.240 N ZDHHC2 n/a
4 TRCN0000124893 CCTTTCCAACTTGCCTTGTTA pLKO.1 1702 CDS 100% 5.625 3.938 N Zdhhc2 n/a
5 TRCN0000144270 CGACATGGAACAGATAAGAAT pLKO.1 1581 CDS 100% 5.625 3.938 N ZDHHC2 n/a
6 TRCN0000122867 GCCAAGGATCTTCCCATCTAT pLKO.1 1161 CDS 100% 5.625 3.938 N ZDHHC2 n/a
7 TRCN0000139146 CCTCAGACTGAGTGAACTGTA pLKO.1 2447 3UTR 100% 4.950 3.465 N ZDHHC2 n/a
8 TRCN0000140734 GCCTCACTTAATTCCAGCCTT pLKO.1 2529 3UTR 100% 2.640 1.848 N ZDHHC2 n/a
9 TRCN0000144309 CATCTCTCTTATGCAGAGAAA pLKO.1 1083 CDS 100% 0.495 0.347 N ZDHHC2 n/a
10 TRCN0000143212 GAATGGATTCAGCTTGGGTTT pLKO.1 1598 CDS 100% 4.050 2.430 N ZDHHC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544544.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14142 pDONR223 100% 88.9% 69.7% None (many diffs) n/a
2 ccsbBroad304_14142 pLX_304 0% 88.9% 69.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000491998 GAGCACACAGACTGATTCGAAATA pLX_317 34.1% 88.9% 69.7% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV