Transcript: Mouse NM_178395.3

Mus musculus zinc finger, DHHC domain containing 2 (Zdhhc2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Zdhhc2 (70546)
Length:
2498
CDS:
229..1329

Additional Resources:

NCBI RefSeq record:
NM_178395.3
NBCI Gene record:
Zdhhc2 (70546)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178395.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124889 GCATTGACTATGAACTCATTA pLKO.1 1849 3UTR 100% 13.200 18.480 N Zdhhc2 n/a
2 TRCN0000124890 CGGAACAGATAAGAACGGATT pLKO.1 984 CDS 100% 4.050 5.670 N Zdhhc2 n/a
3 TRCN0000124891 CCCTGCATTAACTATGGAGAA pLKO.1 1299 CDS 100% 4.050 3.240 N Zdhhc2 n/a
4 TRCN0000144269 CTTTCCAACTTGCCTTGTTAA pLKO.1 1101 CDS 100% 13.200 9.240 N ZDHHC2 n/a
5 TRCN0000124892 GCATTCAGAAATCCAGTATTT pLKO.1 958 CDS 100% 13.200 9.240 N Zdhhc2 n/a
6 TRCN0000124893 CCTTTCCAACTTGCCTTGTTA pLKO.1 1100 CDS 100% 5.625 3.938 N Zdhhc2 n/a
7 TRCN0000144309 CATCTCTCTTATGCAGAGAAA pLKO.1 481 CDS 100% 0.495 0.297 N ZDHHC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178395.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14142 pDONR223 100% 91% 94.2% None (many diffs) n/a
2 ccsbBroad304_14142 pLX_304 0% 91% 94.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000491998 GAGCACACAGACTGATTCGAAATA pLX_317 34.1% 91% 94.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV