Construct: ORF TRCN0000492011
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008974.1_s317c1
- Derived from:
- ccsbBroadEn_14271
- DNA Barcode:
- GCTAGCCTTTATCATAACACCTAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- SUGCT (79783)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492011
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | NM_001193312.1 | 98.1% | 47.3% | (many diffs) |
2 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | XM_011515529.3 | 92.1% | 44.4% | (many diffs) |
3 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | NM_001193313.1 | 88% | 42.2% | (many diffs) |
4 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | XM_011515527.3 | 86.8% | 41.8% | (many diffs) |
5 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | NM_001193311.1 | 83.2% | 39.9% | (many diffs) |
6 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | XM_006715775.3 | 83.2% | 39.9% | (many diffs) |
7 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | XM_011515525.3 | 78.9% | 37.8% | (many diffs) |
8 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | XM_011515528.3 | 78% | 44.1% | (many diffs) |
9 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | XM_017012622.2 | 77% | 43.2% | (many diffs) |
10 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | NM_024728.2 | 75.4% | 32% | (many diffs) |
11 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | XM_011515526.2 | 71% | 30.1% | (many diffs) |
12 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | XM_017012621.1 | 70.6% | 29.5% | (many diffs) |
13 | human | 79783 | SUGCT | succinyl-CoA:glutarate-CoA ... | XM_011515530.3 | 54% | 63.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 639
- ORF length:
- 570
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccatctgag acgcacgcga tgctggcgac gctggcgagg gtggcagctc 121 tgcgcagaac ctgcctcttc tccggccggg gcggcgggag ggggctgtgg actggccgcc 181 cgcagtcaga tatgaacaat ataaagccat tggaaggggt aaaaattctg gatctaacaa 241 gagtcctggc gggacctttt gctactatga atttaggaga tcttggagca gaagttataa 301 aagtggagag accaggagct ggtgatgata cacgaacttg ggggccacct tttgttggga 361 cagaaagtac atattatctc agtgttaacc gaaataaaaa aagtattgct gttaatatca 421 aggatccaaa aggggtgaaa atcatcaaag agcttgcagc tgtttgtgat gtgtttgtgg 481 aaaactatgt ccctggcaaa ctgtctgcaa tgggcctggg atatgaagat atagacgaga 541 ttgctcctca catcatctat tgttccatca cagggtatgg tcagacaggt ccaatttctc 601 agcgagctgg ttatgatgct gttgcctcgg catgtttcta gntntgattc gcnnntcact 661 ccaggatggc gtagctttgt ctcacgatga gctgcaagat tatcttattg gtcaaaagga 721 agcaaaacgt tggggtacag ctcatggcag tatcgttcct taccaggctt ttaaaaccaa 781 ggatggctat attgtagttg gagcaggaaa taaccagcag tttgccaccg tctgcaagat 841 cttggatttg cctGAGTTGA TTGATAATTC CAAGTATAAA ACTAACCACC TTCGGGTACA 901 CAATAGAAAA GAGCTTATTA AAATATTATC TGAACGGTTT GAAGAAGAAC TGACCAGCAA 961 GTGGTTATAT CTTTTTGAAG GCAGTGGAGT CCCGTATGGC CCAATCAACA ACATGAAGAA 1021 TGTATTTGCA GAACCTCAGG TATTACACAA TGGCCTCGTT ATGGAGATGG AGCATCCAAC 1081 TGTGGGGAAG ATTTCCGTCC CAGGCCCAGC TGTGAGATAC AGTAAGTTCA AGATGTCAGA 1141 GGCCAGGCCG CCCCCGCTGC TCGGGCAGCA CACAACGCAC ATCCTGAAGG AGGTCCTGAG 1201 ATACGATGAC AGGGCCATCG GGGAGCTGCT CAGCGCTGGA GTGGTGGACC AACATGAAAC 1261 TCACTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT 1321 CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC 1381 TTGGCTTTAT ATATCTTGTG GAAAGGACGA GCTAGCCTTT ATCATAACAC CTACACGCGT 1441 TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt