Transcript: Human NM_001193311.1

Homo sapiens succinyl-CoA:glutarate-CoA transferase (SUGCT), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-10-14
Taxon:
Homo sapiens (human)
Gene:
SUGCT (79783)
Length:
1745
CDS:
25..1440

Additional Resources:

NCBI RefSeq record:
NM_001193311.1
NBCI Gene record:
SUGCT (79783)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001193311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153988 CCTTCGGGTACACAATAGAAA pLKO.1 984 CDS 100% 5.625 7.875 N SUGCT n/a
2 TRCN0000153936 CTGGTGATGATACACGAACTT pLKO.1 275 CDS 100% 4.950 6.930 N SUGCT n/a
3 TRCN0000336747 CTGGTGATGATACACGAACTT pLKO_005 275 CDS 100% 4.950 6.930 N SUGCT n/a
4 TRCN0000158164 CGATCCGAATACACTGGCAAA pLKO.1 1470 3UTR 100% 4.050 5.670 N SUGCT n/a
5 TRCN0000350825 CGATCCGAATACACTGGCAAA pLKO_005 1470 3UTR 100% 4.050 5.670 N SUGCT n/a
6 TRCN0000152629 GTATTACACAATGGCCTCGTT pLKO.1 1213 CDS 100% 2.640 3.696 N SUGCT n/a
7 TRCN0000153099 GCAGGAAATAACCAGCAGTTT pLKO.1 898 CDS 100% 4.950 3.960 N SUGCT n/a
8 TRCN0000336755 GCAGGAAATAACCAGCAGTTT pLKO_005 898 CDS 100% 4.950 3.960 N SUGCT n/a
9 TRCN0000152533 GTATGGCCCAATCAACAACAT pLKO.1 1089 CDS 100% 4.950 3.960 N SUGCT n/a
10 TRCN0000336826 TCTCAGTGTTAACCGAAATAA pLKO_005 333 CDS 100% 15.000 10.500 N SUGCT n/a
11 TRCN0000158082 CCCAGCTGTGAGATACAGTAA pLKO.1 1278 CDS 100% 4.950 3.465 N SUGCT n/a
12 TRCN0000336825 CCCAGCTGTGAGATACAGTAA pLKO_005 1278 CDS 100% 4.950 3.465 N SUGCT n/a
13 TRCN0000153987 CCTGTATGCATATGGAGCTAT pLKO.1 672 CDS 100% 0.000 0.000 N SUGCT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001193311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08958 pDONR223 100% 99.8% 99.7% None 678A>N;729A>G n/a
2 ccsbBroad304_08958 pLX_304 0% 99.8% 99.7% V5 678A>N;729A>G n/a
3 TRCN0000469305 GGGGCGAGCTCCCCTATAAGAGTT pLX_317 29.5% 99.8% 99.7% V5 678A>N;729A>G n/a
4 ccsbBroadEn_14271 pDONR223 100% 83.2% 39.9% None (many diffs) n/a
5 ccsbBroad304_14271 pLX_304 0% 83.2% 39.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000492011 GCTAGCCTTTATCATAACACCTAC pLX_317 34.6% 83.2% 39.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV