Construct: ORF TRCN0000492048
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017101.1_s317c1
- Derived from:
- ccsbBroadEn_08598
- DNA Barcode:
- AGCTAATAAACATTTGAACCATAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PLGRKT (55848)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492048
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55848 | PLGRKT | plasminogen receptor with a... | NM_018465.4 | 100% | 100% | |
2 | human | 55848 | PLGRKT | plasminogen receptor with a... | XM_005251510.5 | 100% | 100% | |
3 | human | 55848 | PLGRKT | plasminogen receptor with a... | XM_011517960.2 | 100% | 100% | |
4 | human | 55848 | PLGRKT | plasminogen receptor with a... | XM_005251512.4 | 77.5% | 77.5% | 0_1ins99 |
5 | mouse | 67759 | Plgrkt | plasminogen receptor, C-ter... | NM_026362.2 | 85.2% | 82.3% | (many diffs) |
6 | mouse | 67759 | Plgrkt | plasminogen receptor, C-ter... | XM_011247325.2 | 85.2% | 82.3% | (many diffs) |
7 | mouse | 67759 | Plgrkt | plasminogen receptor, C-ter... | XM_011247326.2 | 85.2% | 82.3% | (many diffs) |
8 | mouse | 67759 | Plgrkt | plasminogen receptor, C-ter... | XM_017318283.1 | 85.2% | 82.3% | (many diffs) |
9 | mouse | 67759 | Plgrkt | plasminogen receptor, C-ter... | XM_017318284.1 | 85.2% | 82.3% | (many diffs) |
10 | mouse | 67759 | Plgrkt | plasminogen receptor, C-ter... | XM_017318285.1 | 85.2% | 82.3% | (many diffs) |
11 | mouse | 67759 | Plgrkt | plasminogen receptor, C-ter... | XM_017318286.1 | 85.2% | 82.3% | (many diffs) |
12 | mouse | 67759 | Plgrkt | plasminogen receptor, C-ter... | XM_017318287.1 | 85.2% | 82.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 507
- ORF length:
- 441
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gtttatattt tcaaaatcta tgaatgaaag catgaaaaat caaaaggagt 121 tcatgcttat gaatgctcga cttcagctgg aaaggcagct catcatgcag agtgaaatga 181 gggaaagaca aatggccatg cagattgcgt ggtctcggga attcctcaaa tattttggaa 241 ctttttttgg ccttgcagcc atctctttaa cagctggagc gattaaaaaa aagaagccag 301 ccttcctggt cccgattgtt ccattaagct ttatcctcac ctaccagtat gacttgggCT 361 ATGGAACCCT TTTAGAAAGA ATGAAAGGTG AAGCTGAGGA CATACTGGAA ACAGAAAAGA 421 GTAAATTGCA GCTGCCAAGA GGAATGATCA CTTTTGAAAG CATTGAAAAA GCCAGAAAGG 481 AACAGAGTAG ATTCTTCATA GACAAATGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 541 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 601 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAAGCTAATA 661 AACATTTGAA CCATAAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 721 aagatt