Transcript: Human XM_005251512.4

PREDICTED: Homo sapiens plasminogen receptor with a C-terminal lysine (PLGRKT), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLGRKT (55848)
Length:
786
CDS:
169..513

Additional Resources:

NCBI RefSeq record:
XM_005251512.4
NBCI Gene record:
PLGRKT (55848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251512.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127520 CTTTAACAGCTGGAGCGATTA pLKO.1 269 CDS 100% 10.800 15.120 N PLGRKT n/a
2 TRCN0000130078 CCGATTGTTCCATTAAGCTTT pLKO.1 316 CDS 100% 4.950 6.930 N PLGRKT n/a
3 TRCN0000343097 CCGATTGTTCCATTAAGCTTT pLKO_005 316 CDS 100% 4.950 6.930 N PLGRKT n/a
4 TRCN0000128721 CCAATCAAATCTCAAAGCACA pLKO.1 525 3UTR 100% 2.640 2.112 N PLGRKT n/a
5 TRCN0000343099 CCAATCAAATCTCAAAGCACA pLKO_005 525 3UTR 100% 2.640 2.112 N PLGRKT n/a
6 TRCN0000129285 CCTCACCTACCAGTATGACTT pLKO.1 339 CDS 100% 4.950 3.465 N PLGRKT n/a
7 TRCN0000131229 GCCAGAAAGGAACAGAGTAGA pLKO.1 475 CDS 100% 4.950 3.465 N PLGRKT n/a
8 TRCN0000129518 GCTGAGGACATACTGGAAACA pLKO.1 397 CDS 100% 4.950 3.465 N PLGRKT n/a
9 TRCN0000343160 GCTGAGGACATACTGGAAACA pLKO_005 397 CDS 100% 4.950 3.465 N PLGRKT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251512.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08598 pDONR223 100% 77.5% 77.5% None 0_1ins99 n/a
2 ccsbBroad304_08598 pLX_304 0% 77.5% 77.5% V5 0_1ins99 n/a
3 TRCN0000492048 AGCTAATAAACATTTGAACCATAA pLX_317 34.4% 77.5% 77.5% V5 0_1ins99 n/a
Download CSV