Construct: ORF TRCN0000492049
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012749.1_s317c1
- Derived from:
- ccsbBroadEn_01940
- DNA Barcode:
- AGTCCCAAAATGAATCCCCTGTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC43A1 (8501)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492049
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8501 | SLC43A1 | solute carrier family 43 me... | NM_001198810.2 | 100% | 100% | |
| 2 | human | 8501 | SLC43A1 | solute carrier family 43 me... | NM_003627.6 | 100% | 100% | |
| 3 | human | 8501 | SLC43A1 | solute carrier family 43 me... | XM_017018451.2 | 100% | 100% | |
| 4 | human | 8501 | SLC43A1 | solute carrier family 43 me... | XM_005274358.5 | 97.2% | 97.2% | 1_48del |
| 5 | human | 8501 | SLC43A1 | solute carrier family 43 me... | XM_017018452.1 | 94.4% | 94.4% | 464_465ins93 |
| 6 | human | 8501 | SLC43A1 | solute carrier family 43 me... | XM_011545320.3 | 91.8% | 91.8% | 1_48del;512_513ins93 |
| 7 | human | 8501 | SLC43A1 | solute carrier family 43 me... | XM_024448727.1 | 86.7% | 86.7% | 0_1ins222 |
| 8 | human | 8501 | SLC43A1 | solute carrier family 43 me... | XM_024448728.1 | 86.7% | 86.7% | 0_1ins222 |
| 9 | human | 8501 | SLC43A1 | solute carrier family 43 me... | XM_011545321.2 | 54.2% | 54.2% | 0_1ins768 |
| 10 | human | 8501 | SLC43A1 | solute carrier family 43 me... | XM_011545322.2 | 54.2% | 54.2% | 0_1ins768 |
| 11 | human | 8501 | SLC43A1 | solute carrier family 43 me... | XM_017018453.2 | 54.2% | 54.2% | 0_1ins768 |
| 12 | mouse | 72401 | Slc43a1 | solute carrier family 43, m... | XM_017319274.1 | 67.9% | 67.2% | (many diffs) |
| 13 | mouse | 72401 | Slc43a1 | solute carrier family 43, m... | XM_017319275.1 | 62.2% | 61.1% | (many diffs) |
| 14 | mouse | 72401 | Slc43a1 | solute carrier family 43, m... | XM_017319276.1 | 52.6% | 52.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1743
- ORF length:
- 1677
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ccccacgctg caacaggcgt accggaggcg ctggtggatg gcctgcacgg 121 ctgtgctgga gaacctcttc ttctctgctg tactcctggg ctggggctcc ctgttgatca 181 ttctgaagaa cgagggcttc tattccagca cgtgcccagc tgagagcagc accaacacca 241 cccaggatga gcagcgcagg tggccaggct gtgaccagca ggacgagatg ctcaacctgg 301 gcttcaccat tggttccttc gtgctcagcg ccaccaccct gccactgggg atcctcatgg 361 accgctttgg cccccgaccc gtgcggctgg ttggcagtgc ctgcttcact gcgtcctgca 421 ccctcatggc cctggcctcc cgggacgtgg aagctctgtc tccgttgata ttcctggcgc 481 tgtccctgaa tggctttggt ggcatctgcc taacgttcac ttcactcacg ctgcccaaca 541 tgtttgggaa cctgcgctcc acgttaatgg ccctcatgat tggctcttac gcctcttctg 601 ccattacgtt cccaggaatc aagctgatct acgatgccgg tgtggccttc gtggtcatca 661 tgttcacctg gtctggcctg gcctgcctta tctttctgaa ctgcaccctc aactggccca 721 tcgaagcctt tcctgcccct gaggaagtca attacacgaa gaagatcaag ctgagtgggc 781 tggccctgga ccacaaggtg acaggtgacc tcttctacac ccatgtgacc accatgggcc 841 agaggctcag ccagaaggcc cccagcctgg aggacggttc ggatgccttc atgtcacccc 901 aggatgttcg gggcacctca gaaaaccttc ctgagaggtc tgtcccctta cgcaagagcc 961 tctgctcccc cactttcctg tggagcctcc tcaccatggg catgacccag ctgcggatca 1021 tcttctacat ggctgctgtg aacaagatgc tggagtacct tgtgactggt ggccaggagc 1081 atgagacaaa tgaacagcaa caaaaggtgg cagagacagt tgggttctac tcctccgtct 1141 tcggggccat gcagctgttg tgccttctca cctgccccct cattggctac atcatggact 1201 ggcggatcaa ggactgcgtg gacgccccaa ctcagggcac tgtcctcgga gatgccaggg 1261 acggggttgc taccaaatcc atcagaccac gctactgcaa gatccaaaag ctcaccaatg 1321 ccatcagtgc cttcaccctg accaacctgc tgcttgtgGG TTTTGGCATC ACCTGTCTCA 1381 TCAACAACTT ACACCTCCAG TTTGTGACCT TTGTCCTGCA CACCATTGTT CGAGGTTTCT 1441 TCCACTCAGC CTGTGGGAGT CTCTATGCTG CAGTGTTCCC ATCCAACCAC TTTGGGACGC 1501 TGACAGGCCT GCAGTCCCTC ATCAGTGCTG TGTTCGCCTT GCTTCAGCAG CCACTTTTCA 1561 TGGCGATGGT GGGACCCCTG AAAGGAGAGC CCTTCTGGGT GAATCTGGGC CTCCTGCTAT 1621 TCTCACTCCT GGGATTCCTG TTGCCTTCCT ACCTCTTCTA TTACCGTGCC CGGCTCCAGC 1681 AGGAGTACGC CGCCAATGGG ATGGGCCCAC TGAAGGTGCT TAGCGGCTCT GAGGTGACCG 1741 CATACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1801 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1861 GGCTTTATAT ATCTTGTGGA AAGGACGAAG TCCCAAAATG AATCCCCTGT AAACGCGTTA 1921 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt