Transcript: Human NM_001198810.2

Homo sapiens solute carrier family 43 member 1 (SLC43A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SLC43A1 (8501)
Length:
2384
CDS:
143..1822

Additional Resources:

NCBI RefSeq record:
NM_001198810.2
NBCI Gene record:
SLC43A1 (8501)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001198810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044313 GCACACCATTGTTCGAGGTTT pLKO.1 1495 CDS 100% 4.950 6.930 N SLC43A1 n/a
2 TRCN0000044317 CAAATCCATCAGACCACGCTA pLKO.1 1351 CDS 100% 2.640 3.696 N SLC43A1 n/a
3 TRCN0000421772 AGCTCTGTCTCCGTTGATATT pLKO_005 529 CDS 100% 13.200 9.240 N SLC43A1 n/a
4 TRCN0000426890 ATACCAAGAGAAGTTCTATTT pLKO_005 1942 3UTR 100% 13.200 9.240 N SLC43A1 n/a
5 TRCN0000442146 TCACGCTGCCCAACATGTTTG pLKO_005 603 CDS 100% 10.800 7.560 N SLC43A1 n/a
6 TRCN0000044314 CCTGTTGATCATTCTGAAGAA pLKO.1 247 CDS 100% 4.950 3.465 N SLC43A1 n/a
7 TRCN0000044316 CTTTCTGAACTGCACCCTCAA pLKO.1 769 CDS 100% 4.050 2.835 N SLC43A1 n/a
8 TRCN0000044315 GCTATTCTCACTCCTGGGATT pLKO.1 1693 CDS 100% 4.050 2.835 N SLC43A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001198810.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01940 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01940 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492049 AGTCCCAAAATGAATCCCCTGTAA pLX_317 23.2% 100% 100% V5 n/a
Download CSV