Transcript: Mouse XM_017319274.1

PREDICTED: Mus musculus solute carrier family 43, member 1 (Slc43a1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc43a1 (72401)
Length:
2461
CDS:
568..2382

Additional Resources:

NCBI RefSeq record:
XM_017319274.1
NBCI Gene record:
Slc43a1 (72401)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068932 GCTTCGGGTCATCTTCTATAT pLKO.1 1764 CDS 100% 13.200 18.480 N Slc43a1 n/a
2 TRCN0000068930 GCATACCATAGTTCGCGGTTT pLKO.1 2187 CDS 100% 4.050 5.670 N Slc43a1 n/a
3 TRCN0000068928 CCCTGGAATCAAGCTGATCTA pLKO.1 1365 CDS 100% 4.950 3.960 N Slc43a1 n/a
4 TRCN0000447869 CTCTCATCAGTGCCGTGTTTG pLKO_005 2285 CDS 100% 10.800 7.560 N Slc43a1 n/a
5 TRCN0000068929 GCACTGTCCTTGAATGGATTT pLKO.1 1231 CDS 100% 10.800 7.560 N Slc43a1 n/a
6 TRCN0000442146 TCACGCTGCCCAACATGTTTG pLKO_005 1280 CDS 100% 10.800 7.560 N SLC43A1 n/a
7 TRCN0000068931 CCTGAATGAGAATGCTTCCTT pLKO.1 1995 CDS 100% 3.000 1.800 N Slc43a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01940 pDONR223 100% 67.9% 67.2% None (many diffs) n/a
2 ccsbBroad304_01940 pLX_304 0% 67.9% 67.2% V5 (many diffs) n/a
3 TRCN0000492049 AGTCCCAAAATGAATCCCCTGTAA pLX_317 23.2% 67.9% 67.2% V5 (many diffs) n/a
Download CSV