Construct: ORF TRCN0000492115
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020822.2_s317c1
- DNA Barcode:
- AAAAAGCATTTAGGGCAATGCGTC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NPY1R (4886)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492115
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4886 | NPY1R | neuropeptide Y receptor Y1 | NM_000909.6 | 99.9% | 100% | 75T>C |
| 2 | human | 4886 | NPY1R | neuropeptide Y receptor Y1 | XM_005263031.4 | 99.9% | 100% | 75T>C |
| 3 | human | 4886 | NPY1R | neuropeptide Y receptor Y1 | XM_011532010.3 | 99.9% | 100% | 75T>C |
| 4 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | NM_010934.4 | 85% | 93.4% | (many diffs) |
| 5 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_006509594.3 | 85% | 93.4% | (many diffs) |
| 6 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_006509595.3 | 85% | 93.4% | (many diffs) |
| 7 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_006509596.3 | 85% | 93.4% | (many diffs) |
| 8 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_017312614.1 | 85% | 93.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1224
- ORF length:
- 1152
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaattca acattatttt cccaggttga aaatcattca gtccactcta 121 atttctcaga gaagaatgcc cagctcctgg cttttgaaaa tgatgattgt catctgccct 181 tggccatgat atttacctta gctcttgctt atggagctgt gatcattctt ggtgtctctg 241 gaaacctggc cttgatcata atcatcttga aacaaaagga gatgagaaat gttaccaaca 301 tcctgattgt gaacctttcc ttctcagact tgcttgttgc catcatgtgt ctccccttta 361 catttgtcta cacattaatg gaccactggg tctttggtga ggcgatgtgt aagttgaatc 421 cttttgtgca atgtgtttca atcactgtgt ccattttctc tctggttctc attgctgtgg 481 aacgacatca gctgataatc aaccctcgag ggtggagacc aaataataga catgcttatg 541 taggtattgc tgtgatttgg gtccttgctg tggcttcttc tttgcctttc ctgatctacc 601 aagtaatgac tgatgagccg ttccaaaatg taacacttga tgcgtacaaa gacaaatacg 661 tgtgctttga tcaatttcca tcggactctc ataggttgtc ttataccact ctcctcttgg 721 tgctgcagta ttttggtcca ctttgtttta tatttatttg ctacttcaag atatatatac 781 gcctaaaaag gagaaacaac atgatggaCA AGATGAGAGA CAATAAGTAC AGGTCCAGTG 841 AAACCAAAAG AATCAATATC ATGCTGCTCT CCATTGTGGT AGCATTTGCA GTCTGCTGGC 901 TCCCTCTTAC CATCTTTAAC ACTGTGTTTG ATTGGAATCA TCAGATCATT GCTACCTGCA 961 ACCACAATCT GTTATTCCTG CTCTGCCACC TCACAGCAAT GATATCCACT TGTGTCAACC 1021 CCATATTTTA TGGGTTCCTG AACAAAAACT TCCAGAGAGA CTTGCAGTTC TTCTTCAACT 1081 TTTGTGATTT CCGGTCTCGG GATGATGATT ATGAAACAAT AGCCATGTCC ACGATGCACA 1141 CAGATGTTTC CAAAACTTCT TTGAAGCAAG CAAGCCCAGT CGCATTTAAA AAAATCAACA 1201 ACAATGATGA TAATGAAAAA ATCTAGGACC CAGCTTTCTT GTACAAAGTG GTTGATATCG 1261 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1321 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAAAAAAGCA 1381 TTTAGGGCAA TGCGTCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1441 aagatt