Construct: ORF TRCN0000492145
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009313.1_s317c1
- Derived from:
- ccsbBroadEn_04254
- DNA Barcode:
- GAATTCGACCTACGTCGTCCAAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VANGL1 (81839)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492145
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81839 | VANGL1 | VANGL planar cell polarity ... | NM_001172412.1 | 100% | 100% | |
| 2 | human | 81839 | VANGL1 | VANGL planar cell polarity ... | NM_138959.3 | 100% | 100% | |
| 3 | human | 81839 | VANGL1 | VANGL planar cell polarity ... | NM_001172411.2 | 99.6% | 99.6% | 198_199insGTTCAG |
| 4 | mouse | 229658 | Vangl1 | vang-like 1 (van gogh, Dros... | NM_177545.5 | 88.4% | 95% | (many diffs) |
| 5 | mouse | 229658 | Vangl1 | vang-like 1 (van gogh, Dros... | XM_006501395.3 | 86.2% | 92.7% | (many diffs) |
| 6 | mouse | 229658 | Vangl1 | vang-like 1 (van gogh, Dros... | XM_017319549.1 | 76% | 77.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1638
- ORF length:
- 1572
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga taccgaatcc acttattctg gatattctta ctattcaagt cattcgaaaa 121 aatctcacag acaaggggaa agaactagag agagacacaa gtcaccccgg aataaagacg 181 gcagagggtc agaaaagtct gtcaccattc aacctcccac tggagagccc ctgttgggaa 241 atgattctac tcggacagag gaagttcagg atgacaactg gggagagacc accacggcca 301 tcacaggcac ctcggagcac agcatatccc aagaggacat tgccaggatc agcaaggaca 361 tggaggacag cgtggggctg gattgcaaac gctacctggg cctcaccgtc gcctcttttc 421 ttggacttct agttttcctc acccctattg ccttcatcct tttacctccg atcctgtgga 481 gggatgagct ggagccttgt ggcacaattt gtgaggggct ctttatctcc atggcattca 541 aactcctcat tctgctcata gggacctggg cacttttttt ccgcaagcgg agagctgaca 601 tgccacgggt gtttgtgttt cgtgcccttt tgttggtcct catctttctc tttgtggttt 661 cctattggct tttttacggg gtccgcattt tggactctcg ggaccggaat taccagggca 721 ttgtgcaata tgcagtctcc cttgtggatg ccctcctctt catccattac ctggccatcg 781 tcctgctgga gctcaggcag ctgcagccca tgttcacgct gcaggtggtc cgctccaccg 841 atggcgagtc ccgcttctac agcctgggac acctgagtat ccagcgagca gcattggtgg 901 tcctagaaaa ttactacaaa gatttcacca tctataaccc aaacctccta acagcctcca 961 aattccgagc agccaagcat atggccgggc tgaaagtcta caatgtagat ggccccagta 1021 acaatgccac tggccagtcc cgggccatga ttgctgcagc tgctcggcgc agggactcaa 1081 gccacaacga gttgtattat gaagaggccg aacatgaacg gcgagtaaag aagcggaaag 1141 caaggctggt ggttgcagtg gaagaggcct tcatccacat tcagcgtctc caggctgagg 1201 agcagcagaa agccccaggg gaggtgatgg accctaggga ggccgcccag gccattttcc 1261 cctccatggc cagggctctc cagaagtacc tgcgcatcac ccggcagcag aactaccaca 1321 gcatggagag catcctgcag cacctggcct tctgcatcac caacggcatg acccccaagg 1381 ccttcctaga acggtacctc agtgcgggcc ccaccctgca atatgacaag gaccgctggc 1441 tctctacaca gtggaggctt gtcagtgatg aggctgtgac taatggatta cgggatggaa 1501 ttgtgttcgt ccttaagtgc ttggacttca gcctcgtagt caatgtgaag aaaattccat 1561 tcatcatact ctctgaagag ttcatagacc ccaaatctca caaatttgtc cttcgcttac 1621 agtctGAGAC ATCCGTTTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1681 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1741 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGAATTCG ACCTACGTCG 1801 TCCAAGAACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt