Transcript: Mouse NM_177545.5

Mus musculus vang-like 1 (van gogh, Drosophila) (Vangl1), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Vangl1 (229658)
Length:
4214
CDS:
297..1877

Additional Resources:

NCBI RefSeq record:
NM_177545.5
NBCI Gene record:
Vangl1 (229658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177545.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124689 CGTCCTTAAATGCTTGGACTT pLKO.1 1745 CDS 100% 4.050 5.670 N Vangl1 n/a
2 TRCN0000124691 CCTCCTAACAGCATCCAAATT pLKO.1 1181 CDS 100% 13.200 10.560 N Vangl1 n/a
3 TRCN0000124693 TCCAGCCACAACGAGTTGTAT pLKO.1 1314 CDS 100% 5.625 4.500 N Vangl1 n/a
4 TRCN0000124690 CCAAGGCTTTCCTTGAACGAT pLKO.1 1612 CDS 100% 0.300 0.240 N Vangl1 n/a
5 TRCN0000124692 GCACCTCAGAGCACAGTATAT pLKO.1 544 CDS 100% 13.200 9.240 N Vangl1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3530 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177545.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04254 pDONR223 100% 88.4% 95% None (many diffs) n/a
2 ccsbBroad304_04254 pLX_304 0% 88.4% 95% V5 (many diffs) n/a
3 TRCN0000492145 GAATTCGACCTACGTCGTCCAAGA pLX_317 1.4% 88.4% 95% V5 (many diffs) n/a
Download CSV