Transcript: Human NM_001172411.2

Homo sapiens VANGL planar cell polarity protein 1 (VANGL1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
VANGL1 (81839)
Length:
8665
CDS:
255..1823

Additional Resources:

NCBI RefSeq record:
NM_001172411.2
NBCI Gene record:
VANGL1 (81839)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296633 AGTCTGAGACATCCGTTTAAA pLKO_005 1804 CDS 100% 15.000 21.000 N VANGL1 n/a
2 TRCN0000062088 CGAACATGAACGGCGAGTAAA pLKO.1 1292 CDS 100% 13.200 10.560 N VANGL1 n/a
3 TRCN0000062092 CTCGTAGTCAATGTGAAGAAA pLKO.1 1716 CDS 100% 5.625 4.500 N VANGL1 n/a
4 TRCN0000290421 CTCGTAGTCAATGTGAAGAAA pLKO_005 1716 CDS 100% 5.625 4.500 N VANGL1 n/a
5 TRCN0000062089 CCATTCATCATACTCTCTGAA pLKO.1 1740 CDS 100% 4.950 3.465 N VANGL1 n/a
6 TRCN0000290422 CCATTCATCATACTCTCTGAA pLKO_005 1740 CDS 100% 4.950 3.465 N VANGL1 n/a
7 TRCN0000062091 CTACAAAGATTTCACCATCTA pLKO.1 1097 CDS 100% 4.950 3.465 N VANGL1 n/a
8 TRCN0000062090 GCTCTTTATCTCCATGGCATT pLKO.1 701 CDS 100% 4.050 2.835 N VANGL1 n/a
9 TRCN0000290482 GCTCTTTATCTCCATGGCATT pLKO_005 701 CDS 100% 4.050 2.835 N VANGL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04254 pDONR223 100% 99.6% 99.6% None 198_199insGTTCAG n/a
2 ccsbBroad304_04254 pLX_304 0% 99.6% 99.6% V5 198_199insGTTCAG n/a
3 TRCN0000492145 GAATTCGACCTACGTCGTCCAAGA pLX_317 1.4% 99.6% 99.6% V5 198_199insGTTCAG n/a
Download CSV