Construct: ORF TRCN0000492173
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020360.2_s317c1
- DNA Barcode:
- TCACCCGTAGTGGTGCCTTATAAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- CAMKK1 (84254)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492173
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | NM_032294.3 | 100% | 100% | |
| 2 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XM_017025220.2 | 100% | 100% | |
| 3 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | NM_172206.2 | 94.9% | 94.9% | 1_81del |
| 4 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XM_005256817.1 | 93% | 93% | 685_798del |
| 5 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XM_006721588.3 | 93% | 93% | 685_798del |
| 6 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | NM_172207.2 | 88.7% | 88.7% | 685_798del;1560_1561ins69 |
| 7 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XM_024450996.1 | 88.5% | 88.5% | 1_81del;766_879del |
| 8 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XM_011524031.3 | 84.5% | 84.5% | 1_81del;766_879del;1641_1642ins69 |
| 9 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XR_001752661.2 | 81.4% | 1_312del;995_996ins22;1806_1812delTGAGCCC | |
| 10 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XM_024450997.1 | 58.7% | 56.4% | (many diffs) |
| 11 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XM_011524033.1 | 52.8% | 52.8% | 0_1ins714 |
| 12 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XM_011524035.3 | 52.8% | 52.8% | 0_1ins714 |
| 13 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XM_024450998.1 | 52.8% | 52.8% | 0_1ins714 |
| 14 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XM_024450999.1 | 52.8% | 52.8% | 0_1ins714 |
| 15 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XM_011524032.3 | 48.4% | 41.4% | (many diffs) |
| 16 | human | 84254 | CAMKK1 | calcium/calmodulin dependen... | XR_001752662.2 | 33.4% | (many diffs) | |
| 17 | mouse | 55984 | Camkk1 | calcium/calmodulin-dependen... | NM_018883.2 | 88.6% | 93.4% | (many diffs) |
| 18 | mouse | 55984 | Camkk1 | calcium/calmodulin-dependen... | XM_006533760.3 | 88.6% | 93.4% | (many diffs) |
| 19 | mouse | 55984 | Camkk1 | calcium/calmodulin-dependen... | XM_006533761.3 | 88.6% | 93.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1587
- ORF length:
- 1515
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggagggg ggtccagctg tctgctgcca ggatcctcgg gcagagctgg 121 tagaacgggt ggcagccatc gatgtgactc acttggagga ggcagatggt ggcccagagc 181 ctactagaaa cggtgtggac cccccaccac gggccagagc tgcctctgtg atccctggca 241 gtacttcaag actgctccca gcccggccta gcctctcagc caggaagctt tccctacagg 301 agcggccagc aggaagctat ctggaggcgc aggctgggcc ttatgccacg gggcctgcca 361 gccacatctc cccccgggcc tggcggaggc ccaccatcga gtcccaccac gtggccatct 421 cagatgcaga ggactgcgtg cagctgaacc agtacaagct gcagagtgag attggcaagg 481 gtgcctacgg tgtggtgagg ctggcctaca acgaaagtga agacagacac tatgcaatga 541 aagtcctttc caaaaagaag ttactgaagc agtatggctt tccacgtcgc cctcccccga 601 gagggtccca ggctgcccag ggaggaccag ccaagcagct gctgcccctg gagcgggtgt 661 accaggagat tgccatcctg aagaagctgg accacgtgaa tgtggtcaaa ctgatcgagg 721 tcctggatga cccagctgag gacaacctct atttggtgtt tgacctcctg agaaaggggc 781 ccgtcatgga agtgccctgt gacaagccct tctcggagga gcaagctcgc ctctacctgc 841 gggacgtcat cctgggcctc gagtacttgc actgccagaa gatcgtccac agggacatca 901 agccatccaa cctgctcctg ggggatgatg ggcacgtgaa gatcgccgac tttggcgtca 961 gcaaccagtt tgaggggaac gacgctcagc tgtccagcac ggcgggaacc ccagcattca 1021 tggcccccga ggccatttct gattccggcc agagcttcag tgggaaggcc ttggatgtat 1081 gggccactgg cgtcacgttg tactgctttg tctatgggaa gtgcccattc atcgacgatt 1141 tcatcctggc cctccacagg aagatcaaga atgagcccgt ggtgtttcct GAGGAGCCAG 1201 AAATCAGCGA GGAGCTCAAG GACCTGATCC TGAAGATGTT AGACAAGAAT CCCGAGACGA 1261 GAATTGGGGT GCCAGACATC AAGTTGCACC CTTGGGTGAC CAAGAACGGG GAGGAGCCCC 1321 TTCCTTCGGA GGAGGAGCAC TGCAGCGTGG TGGAGGTGAC AGAGGAGGAG GTTAAGAACT 1381 CAGTCAGGCT CATCCCCAGC TGGACCACGG TGATCCTGGT GAAGTCCATG CTGAGGAAGC 1441 GTTCCTTTGG GAACCCGTTT GAGCCCCAAG CACGGAGGGA AGAGCGATCC ATGTCTGCTC 1501 CAGGAAACCT ACTGGTGAAA GAAGGGTTTG GTGAAGGGGG CAAGAGCCCA GAGCTCCCCG 1561 GCGTCCAGGA AGACGAGGCT GCATCCTAGG ACCCAGCTTT CTTGTACAAA GTGGTTGATA 1621 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1681 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATCACC 1741 CGTAGTGGTG CCTTATAACA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1801 tgaaagatt