Transcript: Mouse NM_018883.2

Mus musculus calcium/calmodulin-dependent protein kinase kinase 1, alpha (Camkk1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Camkk1 (55984)
Length:
3466
CDS:
162..1679

Additional Resources:

NCBI RefSeq record:
NM_018883.2
NBCI Gene record:
Camkk1 (55984)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026995 CACGCTATATTGCTTTGTCTA pLKO.1 1184 CDS 100% 4.950 6.930 N Camkk1 n/a
2 TRCN0000027002 GCGTTCCTTTGGAAACCCATT pLKO.1 1529 CDS 100% 4.050 5.670 N Camkk1 n/a
3 TRCN0000271161 GTGATCCTGGTCAAGTCTATG pLKO_005 1500 CDS 100% 10.800 8.640 N Camkk1 n/a
4 TRCN0000271207 ACCACGTGAATGTAGTCAAAT pLKO_005 781 CDS 100% 13.200 9.240 N Camkk1 n/a
5 TRCN0000027012 CGCTGAAGACAACCTCTATTT pLKO.1 824 CDS 100% 13.200 9.240 N Camkk1 n/a
6 TRCN0000271156 GCGTGGATGCTACGGATAATG pLKO_005 2125 3UTR 100% 13.200 9.240 N Camkk1 n/a
7 TRCN0000271157 GCCGACTTTGGTGTCAGTAAC pLKO_005 1035 CDS 100% 10.800 7.560 N Camkk1 n/a
8 TRCN0000026980 CAGGGACATCAAGCCATCTAA pLKO.1 980 CDS 100% 5.625 3.938 N Camkk1 n/a
9 TRCN0000001980 GACAGACACTATGCAATGAAA pLKO.1 612 CDS 100% 5.625 3.938 N CAMKK1 n/a
10 TRCN0000001981 CTGGCCTACAACGAAAGTGAA pLKO.1 591 CDS 100% 4.950 3.465 N CAMKK1 n/a
11 TRCN0000027017 GCTTACTGATGAAAGAAGGAT pLKO.1 1597 CDS 100% 3.000 2.100 N Camkk1 n/a
12 TRCN0000256589 ACAAGCTGCAGAGTGAGATTG pLKO_005 544 CDS 100% 10.800 6.480 N CAMKK1 n/a
13 TRCN0000284339 GGGTGTCAGATATCAAGTTAC pLKO_005 1357 CDS 100% 10.800 6.480 N Camkk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492173 TCACCCGTAGTGGTGCCTTATAAC pLX_317 26.5% 88.6% 93.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491493 ATTAGACTCCTCTTTCGAACACGT pLX_317 13.4% 88.6% 93.2% V5 (many diffs) n/a
3 ccsbBroadEn_15193 pDONR223 0% 78.9% 82.8% None (many diffs) n/a
4 ccsbBroad304_15193 pLX_304 0% 78.9% 82.8% V5 (many diffs) n/a
5 TRCN0000472786 GTTTCAGGAACTATCAATATATTA pLX_317 28.8% 78.9% 82.8% V5 (many diffs) n/a
6 ccsbBroadEn_09164 pDONR223 100% 78.8% 82.8% None (many diffs) n/a
7 ccsbBroad304_09164 pLX_304 0% 78.8% 82.8% V5 (many diffs) n/a
8 TRCN0000465332 ATTGTATTCATGGAATAGACGTCA pLX_317 23.9% 78.8% 82.8% V5 (many diffs) n/a
Download CSV