Transcript: Human XM_011524035.3

PREDICTED: Homo sapiens calcium/calmodulin dependent protein kinase kinase 1 (CAMKK1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAMKK1 (84254)
Length:
3503
CDS:
804..1607

Additional Resources:

NCBI RefSeq record:
XM_011524035.3
NBCI Gene record:
CAMKK1 (84254)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524035.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199789 GCTGAGGACAACCTCTATTTG pLKO.1 511 5UTR 100% 13.200 18.480 N CAMKK1 n/a
2 TRCN0000199160 CCACGTGAATGTGGTCAAACT pLKO.1 468 5UTR 100% 4.950 6.930 N CAMKK1 n/a
3 TRCN0000001981 CTGGCCTACAACGAAAGTGAA pLKO.1 24 5UTR 100% 4.950 6.930 N CAMKK1 n/a
4 TRCN0000356086 AGCTGAGGACAACCTCTATTT pLKO_005 510 5UTR 100% 13.200 9.240 N CAMKK1 n/a
5 TRCN0000256590 AGAATGAGCCCGTGGTGTTTC pLKO_005 1186 CDS 100% 10.800 7.560 N CAMKK1 n/a
6 TRCN0000356085 GTGCCCATTCATCGACGATTT pLKO_005 1139 CDS 100% 10.800 7.560 N CAMKK1 n/a
7 TRCN0000001980 GACAGACACTATGCAATGAAA pLKO.1 45 5UTR 100% 5.625 3.938 N CAMKK1 n/a
8 TRCN0000001983 CACGTTGTACTGCTTTGTCTA pLKO.1 1112 CDS 100% 4.950 3.465 N CAMKK1 n/a
9 TRCN0000001982 ACAAGAATCCCGAGACGAGAA pLKO.1 1261 CDS 100% 4.050 2.835 N CAMKK1 n/a
10 TRCN0000256592 TGCAGAACCAGGCCCAGAATA pLKO_005 536 5UTR 100% 13.200 7.920 N CAMKK1 n/a
11 TRCN0000256588 GTGACAGAGGAGGAGGTTAAG pLKO_005 1374 CDS 100% 10.800 6.480 N CAMKK1 n/a
12 TRCN0000001984 AGTGCCCATTCATCGACGATT pLKO.1 1138 CDS 100% 4.950 2.970 N CAMKK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524035.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492173 TCACCCGTAGTGGTGCCTTATAAC pLX_317 26.5% 52.8% 52.8% V5 (not translated due to prior stop codon) 0_1ins714 n/a
2 TRCN0000491493 ATTAGACTCCTCTTTCGAACACGT pLX_317 13.4% 52.8% 52.7% V5 0_1ins714;801_802insG n/a
3 ccsbBroadEn_09164 pDONR223 100% 44.8% 44.7% None (many diffs) n/a
4 ccsbBroad304_09164 pLX_304 0% 44.8% 44.7% V5 (many diffs) n/a
5 TRCN0000465332 ATTGTATTCATGGAATAGACGTCA pLX_317 23.9% 44.8% 44.7% V5 (many diffs) n/a
6 ccsbBroadEn_15193 pDONR223 0% 44.8% 44.7% None (many diffs) n/a
7 ccsbBroad304_15193 pLX_304 0% 44.8% 44.7% V5 (many diffs) n/a
8 TRCN0000472786 GTTTCAGGAACTATCAATATATTA pLX_317 28.8% 44.8% 44.7% V5 (many diffs) n/a
Download CSV