Construct: ORF TRCN0000492263
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001303.1_s317c1
- Derived from:
- ccsbBroadEn_11399
- DNA Barcode:
- GAAATGCAGGTCCGAAGGCAGATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WSCD2 (9671)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492263
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9671 | WSCD2 | WSC domain containing 2 | XM_017020249.1 | 48.4% | 48.4% | 1_690del;1043_1044ins60 |
| 2 | human | 9671 | WSCD2 | WSC domain containing 2 | XM_017020250.2 | 48.4% | 48.4% | 1_690del;1043_1044ins60 |
| 3 | human | 9671 | WSCD2 | WSC domain containing 2 | XM_017020251.2 | 48.4% | 48.4% | 1_690del;1043_1044ins60 |
| 4 | human | 9671 | WSCD2 | WSC domain containing 2 | XM_017020252.1 | 48.4% | 48.4% | 1_690del;1043_1044ins60 |
| 5 | human | 9671 | WSCD2 | WSC domain containing 2 | NM_001304447.2 | 40.1% | 40.1% | 1_990del;1343_1344ins60 |
| 6 | human | 9671 | WSCD2 | WSC domain containing 2 | NM_014653.4 | 40.1% | 40.1% | 1_990del;1343_1344ins60 |
| 7 | human | 9671 | WSCD2 | WSC domain containing 2 | XM_017020243.1 | 40.1% | 40.1% | 1_990del;1343_1344ins60 |
| 8 | human | 9671 | WSCD2 | WSC domain containing 2 | XM_017020244.1 | 40.1% | 40.1% | 1_990del;1343_1344ins60 |
| 9 | human | 9671 | WSCD2 | WSC domain containing 2 | XM_017020245.1 | 40.1% | 40.1% | 1_990del;1343_1344ins60 |
| 10 | human | 9671 | WSCD2 | WSC domain containing 2 | XM_017020246.2 | 40.1% | 40.1% | 1_990del;1343_1344ins60 |
| 11 | human | 9671 | WSCD2 | WSC domain containing 2 | XM_017020247.1 | 40.1% | 40.1% | 1_990del;1343_1344ins60 |
| 12 | human | 9671 | WSCD2 | WSC domain containing 2 | XM_017020248.1 | 40.1% | 40.1% | 1_990del;1343_1344ins60 |
| 13 | human | 9671 | WSCD2 | WSC domain containing 2 | XR_001748926.2 | 17.5% | 1_1601del;1955_2172del;2585_4363del | |
| 14 | human | 9671 | WSCD2 | WSC domain containing 2 | XR_001748925.2 | 17.3% | 1_1653del;2007_2224del;2637_4415del | |
| 15 | human | 9671 | WSCD2 | WSC domain containing 2 | XR_001748924.2 | 16.4% | 1_1901del;2255_2472del;2885_4663del | |
| 16 | human | 9671 | WSCD2 | WSC domain containing 2 | XR_944841.2 | 15.1% | 1_2282del;2636_2853del;3266_5044del | |
| 17 | mouse | 320916 | Wscd2 | WSC domain containing 2 | NM_177292.3 | 34.8% | 37.3% | (many diffs) |
| 18 | mouse | 320916 | Wscd2 | WSC domain containing 2 | XM_017320928.1 | 34.8% | 37.3% | (many diffs) |
| 19 | mouse | 320916 | Wscd2 | WSC domain containing 2 | XR_001784707.1 | 11.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 831
- ORF length:
- 765
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cagaaggttc ctgccaggca agtccaagca gctcattgct ttggccagct 121 tcccaggtgc tggcaacacg tgggctcgcc acctcattga attggccaca ggcttctaca 181 ctggcagcta ctacttcgat ggctccctct acaacaaagg gtttaaaggt gagcgggacc 241 actggcgcag cggacggacc atctgcatca agacgcacga aagcggccag aaagagatcg 301 aggccttcga cgccgccatc ctgctcatcc gcaaccccta caaagccctc atggctgagt 361 tcaaccgcaa gtacggcggc cacataggct ttgctgcgca tgcccactgg aagggcaaag 421 gagccgtacc aggatctttg caaatcttat ttcgctcgat ttgcacagca tctgtaggag 481 agtggCCAGA GTTCGTGAGG AACTATGCCC CGTGGTGGGC CACTCACACA CTGGACTGGC 541 TCAAGTTTGG CAAGAAGGTG CTGGTGGTGC ACTTTGAGGA CCTGAAGCAG GACCTCTTTG 601 TCCAGCTGGG CCGGATGGTC AGCCTGCTGG GCGTGGCTGT CAGGGAGGAC CGGCTGCTCT 661 GTGTGGAGAG CCAGAAGGAT GGCAACTTCA AGCGCTCAGG GCTCCGGAAG CTCGAGTATG 721 ACCCCTATAC TGCGGACATG CAGAAGACCA TCTCTGCCTA CATCAAGATG GTGGATGCAG 781 CCCTCAAAGG GCGGAACCTA ACGGGTGTCC CCGATGACTA CTACCCAAGA TGCCCAACTT 841 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 901 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 961 CTTGTGGAAA GGACGAGAAA TGCAGGTCCG AAGGCAGATC ACGCGTTAAG TCgacaatca 1021 acctctggat tacaaaattt gtgaaagatt