Construct: ORF TRCN0000492267
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003115.1_s317c1
- Derived from:
- ccsbBroadEn_01833
- DNA Barcode:
- GCGACGGAGACCAAGCATTCACAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IL1R2 (7850)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492267
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | NM_004633.4 | 100% | 100% | |
| 2 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | XM_006712734.3 | 100% | 100% | |
| 3 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | XM_011511804.3 | 100% | 100% | |
| 4 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | XM_006712736.3 | 94% | 94% | 1_75del |
| 5 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | XM_011511801.2 | 90.2% | 90.2% | 1_129del |
| 6 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | XM_011511805.3 | 79.9% | 77.6% | 1_100del;165_166ins160 |
| 7 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | XM_017004889.1 | 78.6% | 78.6% | 0_1ins255 |
| 8 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | XM_024453129.1 | 78.6% | 78.6% | 0_1ins255 |
| 9 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | NR_048564.2 | 76.2% | 1_217del;1412_1566del | |
| 10 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | XM_011511803.2 | 75.3% | 73.1% | 1_178del;243_244ins160 |
| 11 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | NM_001261419.2 | 74.3% | 74.3% | 888_889ins306 |
| 12 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | XM_011511808.2 | 53.5% | 43.6% | (many diffs) |
| 13 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | XM_011511807.1 | 52.3% | 51.9% | 1_129del;817_818insAAAAAAAAGAAGAGACCAT;822_823ins482 |
| 14 | human | 7850 | IL1R2 | interleukin 1 receptor type 2 | XR_923024.2 | 25% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1260
- ORF length:
- 1194
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt gcgcttgtac gtgttggtaa tgggagtttc tgccttcacc cttcagcctg 121 cggcacacac aggggctgcc agaagctgcc ggtttcgtgg gaggcattac aagcgggagt 181 tcaggctgga aggggagcct gtagccctga ggtgccccca ggtgccctac tggttgtggg 241 cctctgtcag cccccgcatc aacctgacat ggcataaaaa tgactctgct aggacggtcc 301 caggagaaga agagacacgg atgtgggccc aggacggtgc tctgtggctt ctgccagcct 361 tgcaggagga ctctggcacc tacgtctgca ctactagaaa tgcttcttac tgtgacaaaa 421 tgtccattga gctcagagtt tttgagaata cagatgcttt cctgccgttc atctcatacc 481 cgcaaatttt aaccttgtca acctctgggg tattagtatg ccctgacctg agtgaattca 541 cccgtgacaa aactgacgtg aagattcaat ggtacaagga ttctcttctt ttggataaag 601 acaatgagaa atttctaagt gtgaggggga ccactcactt actcgtacac gatgtggccc 661 tggaagatgc tggctattac cgctgtgtcc tgacatttgc ccatgaaggc cagcaataca 721 acatcactag gagtattgag ctacgcatca agaaaaaaaa agaagagacc attcctgtga 781 tcatttcccc cctcaagacc atatcagctt ctctggggtc aagactgaca atcccgtgta 841 aggtgtttct gggaaccggc acacccttaa CCACCATGCT GTGGTGGACG GCCAATGACA 901 CCCACATAGA GAGCGCCTAC CCGGGAGGCC GCGTGACCGA GGGGCCACGC CAGGAATATT 961 CAGAAAATAA TGAGAACTAC ATTGAAGTGC CATTGATTTT TGATCCTGTC ACAAGAGAGG 1021 ATTTGCACAT GGATTTTAAA TGTGTTGTCC ATAATACCCT GAGTTTTCAG ACACTACGCA 1081 CCACAGTCAA GGAAGCCTCC TCCACGTTCT CCTGGGGCAT TGTGCTGGCC CCACTTTCAC 1141 TGGCCTTCTT GGTTTTGGGG GGAATATGGA TGCACAGACG GTGCAAACAC AGAACTGGAA 1201 AAGCAGATGG TCTGACTGTG CTATGGCCTC ATCATCAAGA CTTTCAATCC TATCCCAAGT 1261 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1321 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1381 TTTATATATC TTGTGGAAAG GACGAGCGAC GGAGACCAAG CATTCACAGA CGCGTTAAGT 1441 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt