Transcript: Human XR_923024.2

PREDICTED: Homo sapiens interleukin 1 receptor type 2 (IL1R2), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL1R2 (7850)
Length:
3583
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_923024.2
NBCI Gene record:
IL1R2 (7850)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_923024.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419944 CAATCCCGTGTAAGGTGTTTC pLKO_005 3353 3UTR 100% 10.800 15.120 N IL1R2 n/a
2 TRCN0000058529 CGTGAAGATTCAATGGTACAA pLKO.1 3081 3UTR 100% 4.950 6.930 N IL1R2 n/a
3 TRCN0000058528 CGTTCATCTCATACCCGCAAA pLKO.1 2990 3UTR 100% 4.050 5.670 N IL1R2 n/a
4 TRCN0000415503 GACCATTCCTGTGATCATTTC pLKO_005 3291 3UTR 100% 10.800 7.560 N IL1R2 n/a
5 TRCN0000058531 GCACTACTAGAAATGCTTCTT pLKO.1 2912 3UTR 100% 4.950 3.465 N IL1R2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_923024.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01833 pDONR223 100% 25% None (many diffs) n/a
2 ccsbBroad304_01833 pLX_304 0% 25% V5 (many diffs) n/a
3 TRCN0000492267 GCGACGGAGACCAAGCATTCACAG pLX_317 32.9% 25% V5 (many diffs) n/a
Download CSV