Transcript: Human NM_004633.4

Homo sapiens interleukin 1 receptor type 2 (IL1R2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
IL1R2 (7850)
Length:
1462
CDS:
114..1310

Additional Resources:

NCBI RefSeq record:
NM_004633.4
NBCI Gene record:
IL1R2 (7850)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004633.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419944 CAATCCCGTGTAAGGTGTTTC pLKO_005 877 CDS 100% 10.800 15.120 N IL1R2 n/a
2 TRCN0000058529 CGTGAAGATTCAATGGTACAA pLKO.1 605 CDS 100% 4.950 6.930 N IL1R2 n/a
3 TRCN0000058528 CGTTCATCTCATACCCGCAAA pLKO.1 514 CDS 100% 4.050 5.670 N IL1R2 n/a
4 TRCN0000058530 TGTCCATAATACCCTGAGTTT pLKO.1 1094 CDS 100% 4.950 3.960 N IL1R2 n/a
5 TRCN0000415503 GACCATTCCTGTGATCATTTC pLKO_005 815 CDS 100% 10.800 7.560 N IL1R2 n/a
6 TRCN0000058531 GCACTACTAGAAATGCTTCTT pLKO.1 436 CDS 100% 4.950 3.465 N IL1R2 n/a
7 TRCN0000058532 GAACTACATTGAAGTGCCATT pLKO.1 1022 CDS 100% 4.050 2.835 N IL1R2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004633.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01833 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01833 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492267 GCGACGGAGACCAAGCATTCACAG pLX_317 32.9% 100% 100% V5 n/a
Download CSV