Construct: ORF TRCN0000492289
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001986.1_s317c1
- Derived from:
- ccsbBroadEn_13277
- DNA Barcode:
- GGCCCTCACCACCCCGAGTGTCTA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- RMDN2 (151393)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492289
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 151393 | RMDN2 | regulator of microtubule dy... | NM_001170791.3 | 96.8% | 96.8% | 1_39del |
| 2 | human | 151393 | RMDN2 | regulator of microtubule dy... | NM_001170792.2 | 96.8% | 96.8% | 1_39del |
| 3 | human | 151393 | RMDN2 | regulator of microtubule dy... | NM_001322211.1 | 96.8% | 96.8% | 1_39del |
| 4 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_017003478.1 | 95.5% | 95.6% | 1_39del;1230_1245delinsG |
| 5 | human | 151393 | RMDN2 | regulator of microtubule dy... | NM_001322212.2 | 93% | 92.6% | (many diffs) |
| 6 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_017003476.2 | 90.7% | 90.6% | 1_39del;1230_1311delinsG |
| 7 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_017003477.2 | 90.7% | 90.6% | 1_39del;1230_1311delinsG |
| 8 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_011532616.2 | 89% | 87.2% | (many diffs) |
| 9 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_011532617.2 | 89% | 87.2% | (many diffs) |
| 10 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_011532618.2 | 89% | 87.2% | (many diffs) |
| 11 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_011532619.2 | 89% | 87.2% | (many diffs) |
| 12 | human | 151393 | RMDN2 | regulator of microtubule dy... | NM_001170793.2 | 66.2% | 64.8% | (many diffs) |
| 13 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_017003479.1 | 60.3% | 57.1% | (many diffs) |
| 14 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_017003474.1 | 57.7% | 46.6% | (many diffs) |
| 15 | human | 151393 | RMDN2 | regulator of microtubule dy... | NM_144713.5 | 55.7% | 44.2% | (many diffs) |
| 16 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_017003475.2 | 55.7% | 44.2% | (many diffs) |
| 17 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_011532615.3 | 55.7% | 44.8% | (many diffs) |
| 18 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_011532613.3 | 54.6% | 42.6% | (many diffs) |
| 19 | human | 151393 | RMDN2 | regulator of microtubule dy... | XM_011532614.3 | 54.6% | 42.6% | (many diffs) |
| 20 | human | 151393 | RMDN2 | regulator of microtubule dy... | XR_939668.3 | 23.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1257
- ORF length:
- 1191
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gggcactgct ggaatcagct tgctgctctt gtggtaccac aaggtccgta 121 aaccagggat agcaatgaag ttacctgaat ttctttctct gggtaataca tttaattcaa 181 taactttgca agatgaaata catgatgacc aaggaacaac agtaatcttt caagaaaggc 241 aacttcagat actggagaag ttaaacgaat tactgacaaa tatggaagaa ctcaaagagg 301 aaatcagatt tcttaaagaa gctattccaa agctggagga atatatacaa gatgaacttg 361 gagggaaaat aactgttcat aagataagcc ctcagcacag agcgagaaaa agaagactcc 421 ccacaattca aagttcagca acaagtaata gttcagagga agcagaaagt gaaggagggt 481 atattacagc taatactgac acagaagaac agagttttcc agtccctaag gcatttaaca 541 cacgtgtaga ggaattaaat ttagatgtcc ttcttcagaa ggtagatcat ttacgtatga 601 gtgagtctgg caagtcggag agttttgaac tacttcgtga ccacaaagaa aagtttagag 661 atgaaataga gtttatgtgg cgatttgctc gtgcttatgg agacatgtat gaactatcta 721 caaacacaca agaaaagaaa cattatgcta atattggaaa aactttaagt gaaagagcta 781 ttaatagagc acccatgaat ggacattgtc atctgtggta tgcagttttg tgtggctatg 841 tatctgagtt tgagggttta caaaacaaaa TCAACTATGG GCACCTCTTC AAGGAACATC 901 TAGATATAGC AATCAAACTT TTACCAGAGG AACCCTTTCT ATATTACCTC AAAGGGAGAT 961 ACTGCTATAC TGTCTCAAAA CTGAGCTGGA TTGAGAAAAA AATGGCTGCT ACTCTGTTTG 1021 GAAAAATACC ATCTTCAACT GTACAAGAAG CTTTACACAA TTTCCTTAAG GCTGAAGAAC 1081 TATGCCCTGG TTATTCTAAT CCCAATTACA TGTACTTAGC AAAGTGTTAT ACTGATCTTG 1141 AGGAAAACCA GAATGCTTTG AAGTTCTGTA ATTTGGCTTT ATTGCTTCCT ACTGTTACCA 1201 AAGAGGATAA AGAGGCACAG AAAGAGATGC AAAAAATAAT GACTTCCTTG AAGAGGTAAC 1261 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1321 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1381 ATATATCTTG TGGAAAGGAC GAGGCCCTCA CCACCCCGAG TGTCTAACGC GTTAAGTCga 1441 caatcaacct ctggattaca aaatttgtga aagatt