Transcript: Human XM_011532613.3

PREDICTED: Homo sapiens regulator of microtubule dynamics 2 (RMDN2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RMDN2 (151393)
Length:
2521
CDS:
117..1967

Additional Resources:

NCBI RefSeq record:
XM_011532613.3
NBCI Gene record:
RMDN2 (151393)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532613.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365448 AGTATATCTCTTGGTCATAAA pLKO_005 231 CDS 100% 13.200 18.480 N RMDN2 n/a
2 TRCN0000376598 TGGCGATTTGCTCGTGCTTAT pLKO_005 1302 CDS 100% 10.800 15.120 N RMDN2 n/a
3 TRCN0000145452 GATACTGCTATACTGTCTCAA pLKO.1 1582 CDS 100% 4.950 6.930 N RMDN2 n/a
4 TRCN0000365445 AGACGTTTCTCATCCCGTAAA pLKO_005 489 CDS 100% 10.800 8.640 N RMDN2 n/a
5 TRCN0000365447 CACAGGCTTCACTGATATAAA pLKO_005 428 CDS 100% 15.000 10.500 N RMDN2 n/a
6 TRCN0000365505 TCCCACCTCAAAGCGAATTAA pLKO_005 997 CDS 100% 15.000 10.500 N RMDN2 n/a
7 TRCN0000370632 TCTTCAGAAGGTAGATCATTT pLKO_005 1196 CDS 100% 13.200 9.240 N RMDN2 n/a
8 TRCN0000144481 CCTATTACAAGAGTGCCATTT pLKO.1 523 CDS 100% 10.800 7.560 N RMDN2 n/a
9 TRCN0000122181 GCAACAAAGTAGAGCTAACTT pLKO.1 392 CDS 100% 5.625 3.938 N RMDN2 n/a
10 TRCN0000139205 CCAACGATGTTCTCCAGAAGA pLKO.1 158 CDS 100% 4.950 3.465 N RMDN2 n/a
11 TRCN0000140580 GCACCTCTTCAAGGAACATCT pLKO.1 1505 CDS 100% 4.950 3.465 N RMDN2 n/a
12 TRCN0000145164 GCTAATACTGACACAGAAGAA pLKO.1 1113 CDS 100% 4.950 3.465 N RMDN2 n/a
13 TRCN0000145493 GCTTTATTGCTTCCTACTGTT pLKO.1 1800 CDS 100% 4.950 3.465 N RMDN2 n/a
14 TRCN0000121917 CCTGGTTATTCTAATCCCAAT pLKO.1 1710 CDS 100% 4.050 2.835 N RMDN2 n/a
15 TRCN0000370561 GACCATTGTGGTAGCTTTATT pLKO_005 459 CDS 100% 15.000 9.000 N RMDN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532613.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13277 pDONR223 100% 54.6% 42.6% None (many diffs) n/a
2 ccsbBroad304_13277 pLX_304 0% 54.6% 42.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000492289 GGCCCTCACCACCCCGAGTGTCTA pLX_317 32.7% 54.6% 42.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV