Transcript: Human XM_017003477.2

PREDICTED: Homo sapiens regulator of microtubule dynamics 2 (RMDN2), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RMDN2 (151393)
Length:
1516
CDS:
188..1501

Additional Resources:

NCBI RefSeq record:
XM_017003477.2
NBCI Gene record:
RMDN2 (151393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003477.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376598 TGGCGATTTGCTCGTGCTTAT pLKO_005 839 CDS 100% 10.800 15.120 N RMDN2 n/a
2 TRCN0000145452 GATACTGCTATACTGTCTCAA pLKO.1 1119 CDS 100% 4.950 6.930 N RMDN2 n/a
3 TRCN0000370632 TCTTCAGAAGGTAGATCATTT pLKO_005 733 CDS 100% 13.200 9.240 N RMDN2 n/a
4 TRCN0000140580 GCACCTCTTCAAGGAACATCT pLKO.1 1042 CDS 100% 4.950 3.465 N RMDN2 n/a
5 TRCN0000145164 GCTAATACTGACACAGAAGAA pLKO.1 650 CDS 100% 4.950 3.465 N RMDN2 n/a
6 TRCN0000145493 GCTTTATTGCTTCCTACTGTT pLKO.1 1337 CDS 100% 4.950 3.465 N RMDN2 n/a
7 TRCN0000121917 CCTGGTTATTCTAATCCCAAT pLKO.1 1247 CDS 100% 4.050 2.835 N RMDN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003477.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13277 pDONR223 100% 90.7% 90.6% None 1_39del;1230_1311delinsG n/a
2 ccsbBroad304_13277 pLX_304 0% 90.7% 90.6% V5 (not translated due to prior stop codon) 1_39del;1230_1311delinsG n/a
3 TRCN0000492289 GGCCCTCACCACCCCGAGTGTCTA pLX_317 32.7% 90.7% 90.6% V5 (not translated due to prior stop codon) 1_39del;1230_1311delinsG n/a
Download CSV