Construct: ORF TRCN0000492320
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005855.2_s317c1
- Derived from:
- ccsbBroadEn_04582
- DNA Barcode:
- CGCGCCTCAAGTTCGCTATGAGTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- G6PC3 (92579)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492320
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 92579 | G6PC3 | glucose-6-phosphatase catal... | NM_138387.3 | 100% | 100% | |
2 | human | 92579 | G6PC3 | glucose-6-phosphatase catal... | NR_028582.2 | 71.2% | 1_55del;274_332del;1153_1456del | |
3 | human | 92579 | G6PC3 | glucose-6-phosphatase catal... | XM_011525473.3 | 66.7% | 66.7% | 0_1ins345 |
4 | human | 92579 | G6PC3 | glucose-6-phosphatase catal... | XM_011525474.3 | 66.7% | 66.7% | 0_1ins345 |
5 | human | 92579 | G6PC3 | glucose-6-phosphatase catal... | XM_017025335.2 | 66.7% | 66.7% | 0_1ins345 |
6 | human | 92579 | G6PC3 | glucose-6-phosphatase catal... | NR_028581.2 | 65.2% | 1_55del;274_467del;1288_1591del | |
7 | human | 92579 | G6PC3 | glucose-6-phosphatase catal... | NM_001319945.2 | 56.3% | 42.4% | 415_416ins119;585_586ins334 |
8 | mouse | 68401 | G6pc3 | glucose 6 phosphatase, cata... | NM_175935.3 | 85.4% | 84.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1104
- ORF length:
- 1038
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gtccacgctg ggcgcgggca tcgtgatagc cgaggcgcta cagaaccagc 121 tagcctggct ggagaacgtg tggctctgga tcacctttct gggcgatccc aagatcctct 181 ttctgttcta cttccccgcg gcctactacg cctcccgccg tgtgggcatc gcggtgctct 241 ggatcagcct catcaccgag tggctcaacc tcatcttcaa gtggtttctt tttggagaca 301 ggcccttttg gtgggtccat gagtctggtt actacagcca ggctccagcc caggttcacc 361 agttcccctc ttcttgtgag actggtccag gcagcccttc tggacactgc atgatcacag 421 gagcagccct ctggcccata atgacggccc tgtcttcgca ggtggccact cgggcccgca 481 gccgctgggt aagggtgatg cctagcctgg cttattgcac cttccttttg gcggttggct 541 tgtcgcgaat cttcatctta gcacatttcc ctcaccaggt gctggctggc ctaataactg 601 gcgctgtcct gggctggctg atgactcccc gagtgcctat ggagcgggag ctaagcttct 661 atgggttgac tgcactggcc ctcatgctag gcaccagcct catctattgg accctcttta 721 cactgggcct ggatctttct tggtccatca gcctagcctt caagtggtgt gagcggcctg 781 agtggataca cgtggatagc cggccctttg cctcccTGAG CCGTGACTCA GGGGCTGCCC 841 TGGGCCTGGG CATTGCCTTG CACTCTCCCT GCTATGCCCA GGTGCGTCGG GCACAGCTGG 901 GAAATGGCCA GAAGATAGCC TGCCTTGTGC TGGCCATGGG GCTGCTGGGC CCCCTGGACT 961 GGCTGGGCCA CCCCCCTCAG ATCAGCCTCT TCTACATTTT CAATTTCCTC AAGTACACCC 1021 TCTGGCCATG CCTAGTCCTG GCCCTCGTGC CCTGGGCAGT GCACATGTTC AGTGCCCAGG 1081 AAGCACCGCC CATCCACTCT TCCTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1141 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1201 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC GCGCCTCAAG 1261 TTCGCTATGA GTAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1321 att