Transcript: Mouse NM_175935.3

Mus musculus glucose 6 phosphatase, catalytic, 3 (G6pc3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
G6pc3 (68401)
Length:
1612
CDS:
228..1268

Additional Resources:

NCBI RefSeq record:
NM_175935.3
NBCI Gene record:
G6pc3 (68401)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081140 CGCAGCTCTTTGGCCTGTAAT pLKO.1 584 CDS 100% 13.200 18.480 N G6pc3 n/a
2 TRCN0000363622 CGCAGCTCTTTGGCCTGTAAT pLKO_005 584 CDS 100% 13.200 18.480 N G6pc3 n/a
3 TRCN0000081142 TGGGCGATCCTAAGAATCTTT pLKO.1 322 CDS 100% 5.625 7.875 N G6pc3 n/a
4 TRCN0000327630 TGGGCGATCCTAAGAATCTTT pLKO_005 322 CDS 100% 5.625 7.875 N G6pc3 n/a
5 TRCN0000081139 CCTCATGTATTGGACTCTCTT pLKO.1 860 CDS 100% 4.950 3.960 N G6pc3 n/a
6 TRCN0000327548 CCTCATGTATTGGACTCTCTT pLKO_005 860 CDS 100% 4.950 3.960 N G6pc3 n/a
7 TRCN0000081138 CCGCTCACCTTGAACTTCATT pLKO.1 1360 3UTR 100% 5.625 3.938 N G6pc3 n/a
8 TRCN0000327572 CCGCTCACCTTGAACTTCATT pLKO_005 1360 3UTR 100% 5.625 3.938 N G6pc3 n/a
9 TRCN0000081141 TGGCTTATTGTACCTTCCTAT pLKO.1 670 CDS 100% 4.950 3.465 N G6pc3 n/a
10 TRCN0000327549 TGGCTTATTGTACCTTCCTAT pLKO_005 670 CDS 100% 4.950 3.465 N G6pc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04582 pDONR223 100% 85.4% 84.1% None (many diffs) n/a
2 ccsbBroad304_04582 pLX_304 0% 85.4% 84.1% V5 (many diffs) n/a
3 TRCN0000492320 CGCGCCTCAAGTTCGCTATGAGTA pLX_317 28.1% 85.4% 84.1% V5 (many diffs) n/a
Download CSV