Transcript: Human NR_028582.2

Homo sapiens glucose-6-phosphatase catalytic subunit 3 (G6PC3), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
G6PC3 (92579)
Length:
1456
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028582.2
NBCI Gene record:
G6PC3 (92579)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028582.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051500 CCCTCAGATCAGCCTCTTCTA pLKO.1 1023 3UTR 100% 4.950 3.465 N G6PC3 n/a
2 TRCN0000290377 CCCTCAGATCAGCCTCTTCTA pLKO_005 1023 3UTR 100% 4.950 3.465 N G6PC3 n/a
3 TRCN0000051498 CCTCATCTATTGGACCCTCTT pLKO.1 747 3UTR 100% 4.050 2.835 N G6PC3 n/a
4 TRCN0000290308 CCTCATCTATTGGACCCTCTT pLKO_005 747 3UTR 100% 4.050 2.835 N G6PC3 n/a
5 TRCN0000381118 TTCCGCACCACCTGGTCTTAG pLKO_005 1278 3UTR 100% 3.600 2.520 N G6PC3 n/a
6 TRCN0000051501 CTGGCTTATTGCACCTTCCTT pLKO.1 556 3UTR 100% 3.000 2.100 N G6PC3 n/a
7 TRCN0000381721 CCCACAAAGCCAACACTCTGT pLKO_005 1185 3UTR 100% 2.640 1.848 N G6PC3 n/a
8 TRCN0000051502 CGTGTGGCTCTGGATCACCTT pLKO.1 127 3UTR 100% 0.880 0.616 N G6PC3 n/a
9 TRCN0000290376 CGTGTGGCTCTGGATCACCTT pLKO_005 127 3UTR 100% 0.880 0.616 N G6PC3 n/a
10 TRCN0000380349 TTCCTTTCCCTCCCACAAAGC pLKO_005 1174 3UTR 100% 4.050 2.430 N G6PC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028582.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04582 pDONR223 100% 71.2% None 1_55del;274_332del;1153_1456del n/a
2 ccsbBroad304_04582 pLX_304 0% 71.2% V5 1_55del;274_332del;1153_1456del n/a
3 TRCN0000492320 CGCGCCTCAAGTTCGCTATGAGTA pLX_317 28.1% 71.2% V5 1_55del;274_332del;1153_1456del n/a
Download CSV