Construct: ORF TRCN0000492329
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011020.1_s317c1
- Derived from:
- ccsbBroadEn_10920
- DNA Barcode:
- GTTCTTAGGATTAGGACAGATTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IL16 (3603)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492329
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 3603 | IL16 | interleukin 16 | NM_001172128.2 | 33.9% | 33.4% | (many diffs) |
2 | human | 3603 | IL16 | interleukin 16 | NM_172217.5 | 33.8% | 33.4% | (many diffs) |
3 | human | 3603 | IL16 | interleukin 16 | NM_001352686.1 | 32.6% | 32.1% | (many diffs) |
4 | human | 3603 | IL16 | interleukin 16 | NM_001352685.2 | 20.6% | 19.7% | (many diffs) |
5 | human | 3603 | IL16 | interleukin 16 | NR_148035.2 | 14.2% | (many diffs) | |
6 | mouse | 16170 | Il16 | interleukin 16 | NM_010551.3 | 28.8% | 29.5% | (many diffs) |
7 | mouse | 16170 | Il16 | interleukin 16 | XM_006507386.3 | 28.8% | 29.5% | (many diffs) |
8 | mouse | 16170 | Il16 | interleukin 16 | XM_011241681.2 | 28.8% | 29.5% | (many diffs) |
9 | mouse | 16170 | Il16 | interleukin 16 | XM_011241680.2 | 28% | 28.7% | (many diffs) |
10 | mouse | 16170 | Il16 | interleukin 16 | XM_006507385.2 | 27.8% | 28.5% | (many diffs) |
11 | mouse | 16170 | Il16 | interleukin 16 | XM_017321989.1 | 26.8% | 27.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1428
- ORF length:
- 1362
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaatag 61 ttggcatgga gtcgcacagc cgcgctggaa agagcagaaa atctgcaaaa tttcggtcca 121 tctccaggtc cctgatgctc tgtaatgcta agaccagtga tgatggctct agccctgatg 181 agaaatatcc tgatcccttt gagatttcct tggcccaggg caaggaggga attttccact 241 catctgtgca gctggcagac acatcggagg ctgggcccag cagtgttcct gatctagcac 301 tggcctcgga ggctgctcaa ctccaagcag ctgggaatga tcgaggcaag acctgtagga 361 ggatattctt catgaaggaa tcttccacag cttcctctcg agaaaagcct ggaaaactag 421 aagcacaaag tagtaacttc ctgtttccta aagcctgcca ccaaagggca cgcagcaact 481 caaccagtgt taatccctat tgcacaagag aaattgattt tccaatgacc aagaaatctg 541 cagcgcccac ggacaggcag ccttactctc tctgcagtaa caggaagtcc ctctctcaac 601 aattggactg tccagcagga aaggctgcgg gaacttcgag accaacacgg tccctgagca 661 cagctcagct cgtgcagcca tctgggggcc tccaggcttc agtcatctcc aacatcgtgc 721 tgatgaaggg ccaggctaag ggtctgggct tcagcatcgt tgggggaaaa gacagcattt 781 atggccccat tgggatttac gtcaaaacca tttttgcagg gggagcagca gcagccgatg 841 gaaggctaca ggaaggtgat gaaattctgg agctcaatgg tgaatcaatg gctggactaa 901 cacatcagga tgctttgcag aagttcaagc aagccaaaaa ggggctcctc accctcaccg 961 tgagaacccg cctgacggcg cctccttccc tgtgcagcca cctgtctccc ccactgtgcc 1021 gctccctgag ctccagcact tgtatcacca aggacagcag ctccttcgcc ttggaaagcc 1081 cctcGGCTCC CATCAGCACC GCCAAGCCCA ATTACAGAAT CATGGTGGAG GTTTCTCTGC 1141 AGAAAGAGGC CGGCGTGGGC CTGGGCATCG GCCTGTGCAG CGTTCCCTAC TTCCAATGCA 1201 TCTCTGGCAT TTTCGTCCAC ACGCTGTCAC CAGGATCCGT GGCGCACCTG GACGGACGTC 1261 TCCGGTGTGG GGACGAGATT GTGGAAATCA GTGATTCCCC TGTGCACTGC CTGACGCTCA 1321 ATGAAGTCTA CACGATCCTG AGTCACTGTG ATCCCGGTCC AGTCTCCATC ATTGTTAGCC 1381 GACATCCAGA CCCACAGAAG GAAGAAATGG AGGCTCAGGA GGTTAAGTAC CCAACTTTCT 1441 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1501 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1561 GTGGAAAGGA CGAGTTCTTA GGATTAGGAC AGATTCCACG CGTTAAGTCg acaatcaacc 1621 tctggattac aaaatttgtg aaagatt