Transcript: Mouse NM_010551.3

Mus musculus interleukin 16 (Il16), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Il16 (16170)
Length:
4989
CDS:
195..4163

Additional Resources:

NCBI RefSeq record:
NM_010551.3
NBCI Gene record:
Il16 (16170)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066500 GACAGCATTTACGGCCCTATT pLKO.1 891 CDS 100% 10.800 15.120 N Il16 n/a
2 TRCN0000066498 GCCTTTGAAGACTCATAACAT pLKO.1 4755 3UTR 100% 5.625 3.938 N Il16 n/a
3 TRCN0000066499 CCTGACTCTCAATGAAGTCTA pLKO.1 1430 CDS 100% 4.950 3.465 N Il16 n/a
4 TRCN0000059131 CGGTTCACAGAGTGTTTCCAA pLKO.1 3592 CDS 100% 3.000 2.100 N IL16 n/a
5 TRCN0000066502 GCCTCTTACCATAAACAGGAT pLKO.1 3947 CDS 100% 2.640 1.848 N Il16 n/a
6 TRCN0000066501 CCAGCTATCATCTGCTGTCAT pLKO.1 3149 CDS 100% 4.950 2.970 N Il16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10920 pDONR223 100% 28.8% 29.5% None (many diffs) n/a
2 ccsbBroad304_10920 pLX_304 0% 28.8% 29.5% V5 (many diffs) n/a
3 TRCN0000492329 GTTCTTAGGATTAGGACAGATTCC pLX_317 25.6% 28.8% 29.5% V5 (many diffs) n/a
Download CSV