Transcript: Human NM_001352686.1

Homo sapiens interleukin 16 (IL16), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
IL16 (3603)
Length:
8449
CDS:
336..4484

Additional Resources:

NCBI RefSeq record:
NM_001352686.1
NBCI Gene record:
IL16 (3603)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352686.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443367 TGGGACCACGTGAGATCATTC pLKO_005 4957 3UTR 100% 10.800 15.120 N IL16 n/a
2 TRCN0000432384 CCCAAACAGTGACATTTATTT pLKO_005 4840 3UTR 100% 15.000 10.500 N IL16 n/a
3 TRCN0000413562 GTTCTGGATGAAGCAACATTA pLKO_005 3783 CDS 100% 13.200 9.240 N IL16 n/a
4 TRCN0000059130 CCAATGGCACTCCCAAAGTTT pLKO.1 2779 CDS 100% 5.625 3.938 N IL16 n/a
5 TRCN0000059128 CCAGTGATGTTTCTGTAGAAT pLKO.1 4144 CDS 100% 5.625 3.938 N IL16 n/a
6 TRCN0000059132 GCTGTGCCTTCCATCTTCTAT pLKO.1 3494 CDS 100% 5.625 3.938 N IL16 n/a
7 TRCN0000059129 CCTCTCACCATTAACAGGATT pLKO.1 4263 CDS 100% 4.950 3.465 N IL16 n/a
8 TRCN0000059131 CGGTTCACAGAGTGTTTCCAA pLKO.1 3907 CDS 100% 3.000 2.100 N IL16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352686.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10920 pDONR223 100% 32.6% 32.1% None (many diffs) n/a
2 ccsbBroad304_10920 pLX_304 0% 32.6% 32.1% V5 (many diffs) n/a
3 TRCN0000492329 GTTCTTAGGATTAGGACAGATTCC pLX_317 25.6% 32.6% 32.1% V5 (many diffs) n/a
Download CSV