Construct: ORF TRCN0000492356
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019790.2_s317c1
- DNA Barcode:
- ATTAACTTACTCAAGTGTGTTCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GALK2 (2585)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492356
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2585 | GALK2 | galactokinase 2 | NM_002044.4 | 99.8% | 99.7% | 1221C>T;1374_1375insG |
| 2 | human | 2585 | GALK2 | galactokinase 2 | XM_005254279.4 | 97.9% | 96.9% | (many diffs) |
| 3 | human | 2585 | GALK2 | galactokinase 2 | XM_006720461.4 | 97.2% | 96.5% | (many diffs) |
| 4 | human | 2585 | GALK2 | galactokinase 2 | NM_001001556.3 | 96.2% | 96% | (many diffs) |
| 5 | human | 2585 | GALK2 | galactokinase 2 | NM_001289030.2 | 94.6% | 94.5% | 0_1ins72;1149C>T;1302_1303insG |
| 6 | human | 2585 | GALK2 | galactokinase 2 | NM_001289031.1 | 94.6% | 94.5% | 0_1ins72;1149C>T;1302_1303insG |
| 7 | human | 2585 | GALK2 | galactokinase 2 | XM_005254280.4 | 94.4% | 93.3% | (many diffs) |
| 8 | human | 2585 | GALK2 | galactokinase 2 | XM_006720462.4 | 92.8% | 91.8% | (many diffs) |
| 9 | human | 2585 | GALK2 | galactokinase 2 | XM_024449892.1 | 92.8% | 91.8% | (many diffs) |
| 10 | human | 2585 | GALK2 | galactokinase 2 | XM_006720463.4 | 90.8% | 89.9% | (many diffs) |
| 11 | human | 2585 | GALK2 | galactokinase 2 | XM_017022062.2 | 87.4% | 87.3% | (many diffs) |
| 12 | human | 2585 | GALK2 | galactokinase 2 | XM_005254284.4 | 87.3% | 86.2% | (many diffs) |
| 13 | human | 2585 | GALK2 | galactokinase 2 | XM_024449893.1 | 86.6% | 85.8% | (many diffs) |
| 14 | human | 2585 | GALK2 | galactokinase 2 | XM_024449894.1 | 85.7% | 84.7% | (many diffs) |
| 15 | human | 2585 | GALK2 | galactokinase 2 | XM_006720464.4 | 79.8% | 78.9% | (many diffs) |
| 16 | human | 2585 | GALK2 | galactokinase 2 | XM_017022063.2 | 76.4% | 75.3% | (many diffs) |
| 17 | human | 2585 | GALK2 | galactokinase 2 | XM_011521441.3 | 70.1% | 69.3% | (many diffs) |
| 18 | human | 2585 | GALK2 | galactokinase 2 | XM_017022064.2 | 70.1% | 69.3% | (many diffs) |
| 19 | human | 2585 | GALK2 | galactokinase 2 | NM_001352047.1 | 69.4% | 68.8% | (many diffs) |
| 20 | human | 2585 | GALK2 | galactokinase 2 | NM_001352048.1 | 69.4% | 68.8% | (many diffs) |
| 21 | human | 2585 | GALK2 | galactokinase 2 | XM_024449895.1 | 64.5% | 64.4% | (many diffs) |
| 22 | human | 2585 | GALK2 | galactokinase 2 | XR_001751207.2 | 63.6% | 1_91del;1058_1227del;1302_1303ins334 | |
| 23 | human | 2585 | GALK2 | galactokinase 2 | XR_001751204.2 | 33% | (many diffs) | |
| 24 | human | 2585 | GALK2 | galactokinase 2 | XR_001751202.2 | 32.3% | (many diffs) | |
| 25 | human | 2585 | GALK2 | galactokinase 2 | XR_001751205.2 | 31.9% | (many diffs) | |
| 26 | human | 2585 | GALK2 | galactokinase 2 | XR_002957633.1 | 31.3% | (many diffs) | |
| 27 | human | 2585 | GALK2 | galactokinase 2 | XR_001751206.2 | 31% | (many diffs) | |
| 28 | human | 2585 | GALK2 | galactokinase 2 | XR_001751208.2 | 30% | (many diffs) | |
| 29 | human | 2585 | GALK2 | galactokinase 2 | NR_147895.2 | 26.2% | (many diffs) | |
| 30 | mouse | 69976 | Galk2 | galactokinase 2 | NM_001291002.1 | 84.8% | 88.6% | (many diffs) |
| 31 | mouse | 69976 | Galk2 | galactokinase 2 | NM_175154.3 | 82% | 84.8% | (many diffs) |
| 32 | mouse | 69976 | Galk2 | galactokinase 2 | XM_006500153.3 | 80.5% | 83.8% | (many diffs) |
| 33 | mouse | 69976 | Galk2 | galactokinase 2 | XM_011239770.2 | 80.5% | 83.8% | (many diffs) |
| 34 | mouse | 69976 | Galk2 | galactokinase 2 | XM_006500154.1 | 69.7% | 69.9% | (many diffs) |
| 35 | mouse | 69976 | Galk2 | galactokinase 2 | XM_011239772.1 | 49.7% | 50.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1446
- ORF length:
- 1377
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggctacagag agccctgcta cgcgtcgggt ccaggtggca gaacatccta 121 ggttactgaa gctaaaggag atgtttaact ccaagtttgg atctattccc aagttttatg 181 ttcgagcacc aggaagagtc aacataatag gagagcatat agattattgt ggatattctg 241 ttcttcctat ggctgtagaa caagatgtgc taatagctgt agaacctgtg aaaacgtacg 301 ctctccaact ggccaataca aatcccttgt atccggactt cagtactagt gctaataaca 361 tccagattga taaaaccaag cctttgtggc acaactattt cttatgtgga cttaaaggaa 421 ttcaggaaca ctttggtctt agtaacctga ctggaatgaa ctgcctggta gatggaaata 481 tcccaccaag ttctggcctc tccagctcca gtgctttggt ctgttgtgct ggcttggtga 541 cgctcacagt gctgggaagg aatctatcca aggtggaact tgcagaaatc tgtgccaaga 601 gtgagcgtta cattggcact gaaggaggag gcatggacca gtctatatca tttcttgcag 661 aagaaggaac tgccaagttg atagaattta gtcctctgag ggcaaccgat gtaaaactcc 721 caagtggagc agtgtttgtg attgccaaca gttgtgtgga gatgaataag gcagcaactt 781 cccatttcaa tatcagggtg atggagtgtc ggctggctgc gaagctcctg gctaaataca 841 aaagcttgca atgggacaaa gtactgaggc tggaggaggt gcaggctaaa ctagggatta 901 gtctagaaga aatgctgttg gtcacagaag atgcccttca tcctgaaccc tataaccctg 961 aggagatctg caggtgtctg ggaattagcc tggaggaact ccgaacccaa atcctgagtc 1021 caaacactca agatgtgctc atcTTCAAAC TCTATCAGCG GGCAAAGCAT GTGTACAGCG 1081 AGGCTGCGCG AGTGCTCCAG TTTAAGAAGA TATGTGAAGA AGCACCTGAA AACATGGTCC 1141 AGCTGCTGGG AGAGTTGATG AACCAGAGCC ACATGAGCTG CCGGGACATG TATGAGTGCA 1201 GCTGCCCCGA GCTGGATCAG CTGGTGGACA TCTGTCGGAA GTTTGGGGCT CAAGGGTCAC 1261 GACTTACTGG AGCAGGATGG GGAGGCTGTA CAGTATCAAT GGTACCTGCG GACAAGCTGC 1321 CCAGCTTTCT AGCAAATGTG CACAAAGCTT ATTACCAGAG GAGTGATGGA AGCTTAGCAC 1381 CGGAGAAGCA AAGTTTGTTT GCTACCAAAC CTGGAGGTGG GGCTTTGGTT TTGCTTGAGG 1441 CCGACCCAGC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1501 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1561 GGCTTTATAT ATCTTGTGGA AAGGACGAAT TAACTTACTC AAGTGTGTTC CTACGCGTTA 1621 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt