Gene: Human LOC392549 (392549)

This gene has been discontinued and we have no replacement information available at this time.

shRNA constructs designed to target this gene

The following shRNA constructs were originally designed to target this discontinued gene.

Target Taxon[?] Target Gene ID Target Gene Symbol Clone ID Target Seq Vector Target Transcript Match Position Match Region[?] Intrinsic Score[?] Adjusted Score[?] Addgene[?]
1 human 392549 LOC392549 TRCN0000036659 CCATGAGAACAACACTCAATA pLKO.1 XM_373373.1 429 CDS 13.200 n/a
2 human 392549 LOC392549 TRCN0000036660 GAATGGGAAGTTTGTTATCAA pLKO.1 XM_373373.1 204 CDS 5.625 n/a
3 human 392549 LOC392549 TRCN0000036661 CCCAAGTTTGTGATGGACATA pLKO.1 XM_373373.1 406 CDS 4.950 n/a
4 human 392549 LOC392549 TRCN0000036663 CCTCAACTACATGGTCTACAT pLKO.1 XM_373373.1 132 CDS 4.950 n/a
5 human 392549 LOC392549 TRCN0000036662 AGAGTAAACGAGTTGGCTGTA pLKO.1 XM_373373.1 35 CDS 4.050 n/a
Download CSV

Additional Resources:

NBCI Gene record:
LOC392549 (392549)